ID: 1143912767

View in Genome Browser
Species Human (GRCh38)
Location 17:10265568-10265590
Sequence ATGGTTAGAAGCAGAATTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143912767_1143912775 16 Left 1143912767 17:10265568-10265590 CCCCCAATTCTGCTTCTAACCAT No data
Right 1143912775 17:10265607-10265629 ACTGTCTTTGTTTTGGGACTTGG No data
1143912767_1143912772 9 Left 1143912767 17:10265568-10265590 CCCCCAATTCTGCTTCTAACCAT No data
Right 1143912772 17:10265600-10265622 TCCGCTGACTGTCTTTGTTTTGG No data
1143912767_1143912774 10 Left 1143912767 17:10265568-10265590 CCCCCAATTCTGCTTCTAACCAT No data
Right 1143912774 17:10265601-10265623 CCGCTGACTGTCTTTGTTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143912767 Original CRISPR ATGGTTAGAAGCAGAATTGG GGG (reversed) Intergenic
No off target data available for this crispr