ID: 1143916370

View in Genome Browser
Species Human (GRCh38)
Location 17:10296319-10296341
Sequence GGTCTTCCACACCATAAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143916370_1143916380 25 Left 1143916370 17:10296319-10296341 CCTATCTTATGGTGTGGAAGACC No data
Right 1143916380 17:10296367-10296389 TTTCCATTTTGCAAGAGAGTAGG No data
1143916370_1143916382 28 Left 1143916370 17:10296319-10296341 CCTATCTTATGGTGTGGAAGACC No data
Right 1143916382 17:10296370-10296392 CCATTTTGCAAGAGAGTAGGAGG No data
1143916370_1143916383 29 Left 1143916370 17:10296319-10296341 CCTATCTTATGGTGTGGAAGACC No data
Right 1143916383 17:10296371-10296393 CATTTTGCAAGAGAGTAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143916370 Original CRISPR GGTCTTCCACACCATAAGAT AGG (reversed) Intergenic
No off target data available for this crispr