ID: 1143917522

View in Genome Browser
Species Human (GRCh38)
Location 17:10304920-10304942
Sequence AGCTGCATGCTCCACTCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 210}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143917520_1143917522 -4 Left 1143917520 17:10304901-10304923 CCAGGGAGGGGCAGCAGCCAGCT 0: 1
1: 0
2: 5
3: 73
4: 680
Right 1143917522 17:10304920-10304942 AGCTGCATGCTCCACTCCACTGG 0: 1
1: 0
2: 2
3: 15
4: 210
1143917512_1143917522 22 Left 1143917512 17:10304875-10304897 CCAACTCCACAATCCAGAGATTG 0: 1
1: 0
2: 2
3: 15
4: 186
Right 1143917522 17:10304920-10304942 AGCTGCATGCTCCACTCCACTGG 0: 1
1: 0
2: 2
3: 15
4: 210
1143917511_1143917522 23 Left 1143917511 17:10304874-10304896 CCCAACTCCACAATCCAGAGATT 0: 1
1: 0
2: 4
3: 30
4: 258
Right 1143917522 17:10304920-10304942 AGCTGCATGCTCCACTCCACTGG 0: 1
1: 0
2: 2
3: 15
4: 210
1143917517_1143917522 9 Left 1143917517 17:10304888-10304910 CCAGAGATTGAAGCCAGGGAGGG 0: 1
1: 0
2: 0
3: 22
4: 278
Right 1143917522 17:10304920-10304942 AGCTGCATGCTCCACTCCACTGG 0: 1
1: 0
2: 2
3: 15
4: 210
1143917513_1143917522 16 Left 1143917513 17:10304881-10304903 CCACAATCCAGAGATTGAAGCCA 0: 1
1: 0
2: 0
3: 13
4: 202
Right 1143917522 17:10304920-10304942 AGCTGCATGCTCCACTCCACTGG 0: 1
1: 0
2: 2
3: 15
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143917522 Original CRISPR AGCTGCATGCTCCACTCCAC TGG Intronic
901197235 1:7447050-7447072 AGCCGCATCCTCCAGTGCACGGG - Intronic
901627911 1:10634196-10634218 AGCCCCATGCCCCACACCACTGG - Intergenic
903373041 1:22849205-22849227 AGCTGAATGCTCTTCTCCTCAGG + Intronic
905787621 1:40770653-40770675 AGCTGCATGCCCCTCTCCCAGGG + Intronic
906407823 1:45556057-45556079 AGCTGCATGGGCCTCTCCTCTGG - Intronic
908425329 1:64001807-64001829 AACTGCAGGCCCCAGTCCACAGG + Intronic
908851519 1:68381486-68381508 AGCTTCATGGTCCACTTCAATGG + Intergenic
910843356 1:91582617-91582639 AGCTCCATGCTCAGCTCCAGGGG - Intergenic
910867894 1:91804569-91804591 AACAGCATGATCCACCCCACAGG + Intronic
911564699 1:99450034-99450056 CGCTGCAAGCTCCACCCCCCGGG - Intergenic
912705391 1:111908027-111908049 AGCTGCAGGCTCCTCTGCAGTGG - Intronic
915596363 1:156898526-156898548 AGCAGCCTGCTGCACTCCACAGG - Intronic
917218217 1:172699908-172699930 AGCTACAGGCTCTACTCCAGAGG + Intergenic
919558746 1:199093377-199093399 CACTGCAGGCTCCACTCCCCGGG + Intergenic
924000811 1:239549583-239549605 TGCTGCAACCTCCACCCCACAGG - Intronic
1063595815 10:7434729-7434751 ACCCGCATGCTCCACTCCTGGGG + Intergenic
1064166732 10:12993105-12993127 AGCTGCCTGCTCCCGTCCAGGGG - Intronic
1066361467 10:34736105-34736127 AGCTGCAAGCTCCACCTCCCGGG + Intronic
1066747480 10:38615759-38615781 AGCTGCATTCTCCTCAGCACAGG - Intergenic
1069176573 10:65296760-65296782 AGCTGCATGCTACATTACTCAGG + Intergenic
1069204263 10:65661945-65661967 AGCTGCCTGCAACACTTCACTGG + Intergenic
1070811740 10:79301527-79301549 AATTGCCTGCCCCACTCCACTGG + Intronic
1070910395 10:80112880-80112902 ACAGGCATGCTCCACTACACTGG + Intergenic
1071368580 10:84927302-84927324 CGCTGCAAGCTCCACTTCCCGGG - Intergenic
1074969875 10:118527322-118527344 GGCTCCTTGCTCCACTCCAAAGG - Intergenic
1075761322 10:124859521-124859543 CGCTGCAACCTCCACTCCCCAGG + Intergenic
1078224754 11:9381946-9381968 CACTGCAAGCTCCACTCCCCGGG + Intergenic
1080942869 11:36939150-36939172 CACTGCAGGCTCCACTCCCCGGG + Intergenic
1081399466 11:42626118-42626140 AGCTGCATGCCCCATTTGACAGG + Intergenic
1083267809 11:61555066-61555088 GGCTTCATGCCCCACTCCTCTGG - Intronic
1083434539 11:62633529-62633551 AGCTGTCTGCTCCAATCCAGAGG + Intronic
1084534077 11:69746542-69746564 AGCAGCAGGCTCCTCACCACCGG - Intergenic
1085953717 11:81365254-81365276 AGATTCATGCTCCATTCCATTGG + Intergenic
1087038050 11:93773719-93773741 GGCTGCATGCTCCACAGAACTGG - Intronic
1087218072 11:95516373-95516395 AGCTGCATGCTGCTGTCCACCGG + Intergenic
1089302904 11:117509381-117509403 AGCTGCATGTTTAACTCCCCAGG - Intronic
1089577735 11:119458703-119458725 CACTGCAGGCTCCACCCCACGGG - Intergenic
1090351368 11:126110578-126110600 AGCTCCATGCCCAGCTCCACAGG + Intergenic
1091682240 12:2535311-2535333 CACTGCAAGCTCCACTCCCCAGG - Intronic
1091843049 12:3634021-3634043 TGCTGCCTCCTCCACCCCACTGG - Intronic
1092497575 12:9012178-9012200 AGCTGCAAGCTCCACTGCCTGGG - Intergenic
1093392132 12:18635945-18635967 ATCAACATGCTCCACACCACTGG + Intronic
1096057389 12:48665486-48665508 TGCTGCATCCTCCACTCCCCTGG - Intronic
1098059668 12:66548077-66548099 AGCTGCATGTTAGAATCCACTGG - Intronic
1098483774 12:70997106-70997128 AGCTCCATGCTGCACTGCAAGGG + Intergenic
1099643999 12:85327173-85327195 TGCTGGATGCTCCAGTCCAGTGG + Intergenic
1101533275 12:105594344-105594366 AGCTGCATGGTCCTCTCCATAGG + Intergenic
1102126222 12:110483246-110483268 AGCTGCAAGCTCCACCTCCCGGG - Intronic
1102571540 12:113829910-113829932 AGCTGCAGGGACCACTCCTCAGG + Intronic
1102930283 12:116856715-116856737 AGCTGACTGCTCTGCTCCACTGG - Exonic
1105736230 13:23274476-23274498 CGCTGCAAGCTCCACCCCCCAGG + Intronic
1105736237 13:23274496-23274518 AGGTGCAAGCTCCACCCCCCAGG + Intronic
1105846385 13:24297785-24297807 AGCTTCATTCTCCACTCCCATGG + Intronic
1106950963 13:34883501-34883523 AGCTGCTGGAGCCACTCCACAGG + Intergenic
1108058090 13:46505178-46505200 AGCTGCGTGTTGCACTACACCGG + Intergenic
1108273337 13:48784072-48784094 AGCTGGATGCCCCACTTCATGGG - Intergenic
1109034826 13:57242754-57242776 AGCTGTCTGCTGAACTCCACTGG - Intergenic
1109156956 13:58923262-58923284 GGCTGCATGGTCCTCTCCAGTGG + Intergenic
1110566706 13:76964768-76964790 AGCTGAAGGCTCCTCTTCACTGG + Intergenic
1111907092 13:94267692-94267714 AGCTTCATGCACCACTCTAAAGG + Intronic
1113543989 13:111131993-111132015 AGGTGCATGCACCCCTCCATGGG - Intronic
1114072242 14:19121514-19121536 CGCTGCAGGCTCCGCTCCCCGGG - Intergenic
1114090015 14:19278459-19278481 CGCTGCAGGCTCCGCTCCCCGGG + Intergenic
1114413008 14:22518212-22518234 AGCTGCATCCTCCAGGACACAGG + Intergenic
1116275815 14:42829828-42829850 ACTTACATGCTCCACTCCAGAGG + Intergenic
1116938901 14:50770785-50770807 AGCTGCAGGCGCCACTGCCCTGG + Intronic
1117323066 14:54642674-54642696 AGCTGGATCATCCACTCAACGGG - Intronic
1117665773 14:58054215-58054237 AGCTCCATTCCCCACTTCACAGG - Intronic
1119296401 14:73537057-73537079 AACTGCAAGCTCCACCCCCCGGG + Intronic
1120166649 14:81208323-81208345 ACCTGCAGGCTCAACACCACAGG - Intronic
1121483062 14:94293047-94293069 ACCTCCATCCTACACTCCACAGG - Intronic
1124021867 15:25932882-25932904 AGCACCTTGCTCCACTCCAGAGG + Intergenic
1124059042 15:26271003-26271025 AGCTGCATGCTCCCCTGCACTGG - Intergenic
1124098966 15:26675590-26675612 AGCTGCAGGATCCACTGCAGTGG - Intronic
1124653717 15:31490722-31490744 ACCTGCAGGCTCCTCTCCACAGG + Intronic
1127132583 15:55882733-55882755 AGCTGCATGCTGCACTGCCTGGG - Intronic
1127966267 15:63924979-63925001 CTCTGCATCCTCCATTCCACTGG - Intronic
1128393840 15:67202898-67202920 TGTTGCATGCTTCTCTCCACAGG - Exonic
1131175104 15:90204355-90204377 AGCTGGACGCTCCACTTCAAGGG - Intronic
1131524828 15:93144288-93144310 AGCTGCAAGCTCCACCTCCCGGG - Intergenic
1133002074 16:2856803-2856825 AGCTGCCAGCTCCACTCACCAGG + Exonic
1135388941 16:22072012-22072034 AACTGCACCTTCCACTCCACTGG - Intronic
1136349101 16:29695451-29695473 ACAGGCATGCTCCACCCCACTGG + Intronic
1136357519 16:29755396-29755418 CGCTGCAAGCTCCACTTCCCAGG + Intergenic
1136386566 16:29930314-29930336 AGCTGCAACCTCCACTTCCCGGG + Intergenic
1138686269 16:58728754-58728776 CACTGCAAGCTCCACTTCACGGG + Intronic
1139327212 16:66161760-66161782 AGCTGCATGCTCCAGCTCAGAGG + Intergenic
1139407963 16:66734597-66734619 AGTTGTACACTCCACTCCACAGG + Intronic
1139443838 16:66984500-66984522 ACCTGCATCCTCCACCCCCCCGG + Intergenic
1139446508 16:67001516-67001538 AAATGTATGCTCCACTGCACAGG + Intronic
1141238490 16:82242728-82242750 AGCTGCATGCCCCTATCCTCAGG + Intergenic
1141892166 16:86933580-86933602 AGCTGCATGCCCCATACCATGGG + Intergenic
1143917522 17:10304920-10304942 AGCTGCATGCTCCACTCCACTGG + Intronic
1144833248 17:18143416-18143438 AGGTGACTGCCCCACTCCACAGG - Intronic
1146019489 17:29265243-29265265 AGCTGCATGCTCCCCTCTTCTGG + Intronic
1146171261 17:30635389-30635411 GGCTGCATGCTCCACCTCCCAGG - Intergenic
1146303335 17:31709189-31709211 CACTGCAAGCTCCACTCCCCGGG - Intergenic
1146344724 17:32051403-32051425 GGCTGCATGCTCCACCTCCCAGG - Intronic
1151604977 17:75130365-75130387 ATCTGCCTGCTCCACTCCACGGG + Exonic
1154120920 18:11651905-11651927 TGCTGCATGGGCCTCTCCACAGG - Intergenic
1159548943 18:69875212-69875234 CGCTGCAAGCTCCACTTCCCAGG + Intronic
1159943851 18:74429062-74429084 TGCTGCCTCCTCCACTCCAGAGG + Intergenic
1160796424 19:947806-947828 ATCTGCCGGCTCCACTCCCCCGG - Intronic
1161489546 19:4554359-4554381 AACTTCATGCCCCACTGCACCGG + Intronic
1162328971 19:10015375-10015397 CACTGCAAGCTCCACCCCACAGG - Intronic
1164575621 19:29403832-29403854 AGCTGCATGAGCCACTCCTGGGG + Intergenic
1166562181 19:43740218-43740240 CCCTGCCTGCTCCTCTCCACAGG - Exonic
925538196 2:4938536-4938558 AGCTGCATGCCCCTCACCAGGGG + Intergenic
927976898 2:27345515-27345537 CGCTGCAACCTCCACCCCACGGG - Intronic
931501663 2:62875343-62875365 GGCTGCATGCTCTAACCCACAGG - Intronic
934928915 2:98404405-98404427 AGCTGCAAGCTGCACTGCATGGG - Intergenic
937414062 2:121700225-121700247 AGGTGCGTGCTGGACTCCACTGG + Intergenic
937714947 2:125021607-125021629 AGGTGGAGGCTCCACTCCAGAGG - Intergenic
937982565 2:127624036-127624058 TGTTGCATGCCCCACCCCACGGG - Intronic
938566522 2:132523740-132523762 AGCTGCATGCTCCGCTGAAGAGG + Intronic
939928781 2:148206045-148206067 TGCTGCAACCTCCACTTCACAGG - Intronic
942315498 2:174693269-174693291 AGCTGCCTGCCCCACTGCAGTGG + Intergenic
945476422 2:210287318-210287340 AGCTGCATCCTACACTGCAGGGG + Intergenic
947799653 2:232920731-232920753 AGCGGCAGGCTCCAGGCCACGGG + Intronic
947979731 2:234398734-234398756 AGCTGCCTGCACCCCACCACAGG - Intergenic
949057646 2:241937144-241937166 AGCTGAGTGCTCCCTTCCACGGG + Intergenic
1171379735 20:24725254-24725276 AGCTGCCTGCTCCACTGCAGTGG - Intergenic
1172801471 20:37579314-37579336 AGCTGGCTTCTCCACTCCCCCGG + Intergenic
1173168846 20:40706086-40706108 AGCTGCATCTTCCCCTCCAAGGG - Intergenic
1174463381 20:50698870-50698892 CACTGCAGGCTCCACTCCTCAGG - Intergenic
1175256528 20:57650999-57651021 GGCACCATGCTCCACCCCACGGG + Exonic
1175493326 20:59393909-59393931 TGCTTCGTGCTCCCCTCCACTGG - Intergenic
1175892998 20:62323521-62323543 GGCTGCCTGCGCCACACCACTGG - Exonic
1176246407 20:64099327-64099349 AGCTGCCTGCTGCACTTCCCGGG - Exonic
1178126253 21:29518597-29518619 AATTGTATGCTCCACTCAACAGG + Intronic
1179138691 21:38703080-38703102 CACTGCAAGCTCCACTCCCCGGG + Intergenic
1180490684 22:15843867-15843889 CGCTGCAGGCTCCGCTCCCCGGG - Intergenic
1180696120 22:17752739-17752761 CACTGCATGCTCCACTTCCCGGG + Intronic
1180856225 22:19047380-19047402 AGCTGCAGCCTCTCCTCCACAGG + Intronic
1181176219 22:21038024-21038046 AACTGCATGCTCCATGCCTCAGG + Intergenic
1183749680 22:39712760-39712782 AGCTCCATCCTCCACACTACAGG + Intergenic
950694280 3:14685935-14685957 CGCTGCAAGCTCCACCTCACAGG + Intronic
951227801 3:20141479-20141501 AGCTGCAAACTCCACCCAACTGG - Intronic
953801894 3:46031046-46031068 GGCTGCATGCTCCACACAGCCGG + Intergenic
954080089 3:48208473-48208495 CACTGCTTGCTCCACTCCAAAGG - Intergenic
954606835 3:51917448-51917470 AGCTGCAAGCTCCACCTCCCAGG - Intergenic
954627903 3:52032754-52032776 ACCTGTAGGCTCAACTCCACTGG + Intergenic
956218349 3:66873482-66873504 TGCTGCAAGCTCCGCCCCACAGG - Intergenic
956785112 3:72636231-72636253 CACTGCAACCTCCACTCCACGGG + Intergenic
956790115 3:72673667-72673689 AGCGGCCTGCTCCCCTTCACCGG - Intergenic
960479871 3:118174831-118174853 AGTGGCATACCCCACTCCACAGG + Intergenic
960805079 3:121575835-121575857 CACTGCAACCTCCACTCCACAGG - Intronic
962146720 3:132847363-132847385 AGCTCCACAGTCCACTCCACTGG - Intergenic
963552964 3:146747831-146747853 AGCTGCATTCTCCCCTCCTGGGG + Intergenic
969261170 4:6034962-6034984 AGCAGCATGCTCCTCTCCTCGGG - Intronic
969444861 4:7239012-7239034 AGCTCCCTGCTGAACTCCACAGG - Intronic
969720416 4:8890464-8890486 CCCTGCAAGCTCCACTCCCCAGG + Intergenic
970394563 4:15653816-15653838 AGCTGCATACTGCACTCAAATGG + Intronic
971280260 4:25237448-25237470 AACTGCAACCTCCACTCCCCAGG + Intronic
971862370 4:32124484-32124506 AGCTGTTTGCTCCATTCCACAGG + Intergenic
974145614 4:57943777-57943799 AGCAGCCTGCTGCGCTCCACAGG + Intergenic
979454313 4:120909255-120909277 AGCTGCATGGTCCACTGCTGAGG + Intronic
979532707 4:121785962-121785984 AGCTACCTACTCCAGTCCACAGG + Intergenic
981315653 4:143337269-143337291 AGCTGCGGGCACCACTCCGCGGG + Intronic
983843152 4:172481999-172482021 GGCTGCAAGCCCCACCCCACCGG + Intronic
983874750 4:172863036-172863058 ACCTGCAGGCTCAACACCACTGG - Intronic
983891928 4:173038420-173038442 AGCTGCTTCCTCCACCCCAGAGG + Intronic
984747926 4:183241012-183241034 TCCTGCAGTCTCCACTCCACAGG + Intronic
985050330 4:185984317-185984339 AACTGCAGCCTCCACTTCACAGG - Intergenic
985100941 4:186458078-186458100 AGCAGCATGCGCAGCTCCACTGG + Intronic
986937193 5:12904239-12904261 AGCTGTATTCTCAACACCACTGG + Intergenic
988040724 5:25886352-25886374 CACTGCAAGCTCCACCCCACGGG - Intergenic
988576337 5:32429059-32429081 AGCTGCAAGCTCCACCTCCCGGG + Intronic
990056836 5:51592446-51592468 CACTGCAAGCTCCACCCCACAGG + Intergenic
990321709 5:54636085-54636107 AGCTGGGTGCTCCAATCCTCTGG + Intergenic
992910888 5:81394595-81394617 AGCTGCTTGCTCCACTTCTCCGG - Intergenic
993200808 5:84812842-84812864 ACCTGCATGCCCAACACCACAGG - Intergenic
997692926 5:135839154-135839176 ATCTGCATGCCCCACTGCAAAGG - Intronic
997888613 5:137655077-137655099 AGCTCCAAGCTACACTCCTCAGG + Intronic
1000816714 5:165931760-165931782 TGCTGCATGAGCCTCTCCACAGG + Intergenic
1001009523 5:168085463-168085485 AGCTGCAGGCACCACTGCTCGGG - Intronic
1001247107 5:170113009-170113031 AACTGCATGCTCCAGTCCCGAGG - Intergenic
1003360719 6:5422506-5422528 AGCCCCATGCTGCCCTCCACTGG - Intronic
1003662323 6:8074197-8074219 AGCTGGATGCTTCACACCAAAGG + Intronic
1004057207 6:12151831-12151853 AGCTGCATGTGGCTCTCCACTGG - Intronic
1005480100 6:26247473-26247495 CACTGCAGGCTCCACCCCACGGG - Intergenic
1005819053 6:29581985-29582007 AGCTGCATGCAGCACACCACTGG - Intronic
1006669395 6:35720268-35720290 AGCTGCATGCTCCAGTTATCAGG - Intronic
1009982409 6:70741863-70741885 ACCTGCAGGCTCAACACCACAGG + Intronic
1010222209 6:73457639-73457661 AGCTGCAAGCAACAATCCACTGG + Intergenic
1012093648 6:94931702-94931724 GGCAGCCTGCCCCACTCCACGGG + Intergenic
1013040697 6:106430634-106430656 AGCTGGCTGAGCCACTCCACTGG + Intergenic
1014611500 6:123553400-123553422 ATCTGTCTGATCCACTCCACAGG + Intronic
1016331108 6:142952689-142952711 ATCATCATGCCCCACTCCACAGG - Intergenic
1018887610 6:167953749-167953771 AGGTGCATGCTCCTCTGCTCTGG + Intronic
1019483924 7:1279351-1279373 AGGTGCATGCACCACCACACCGG - Intergenic
1019844503 7:3484153-3484175 CGAAGCATGCTCCAGTCCACAGG + Intronic
1021854705 7:24843084-24843106 CCCTCCATTCTCCACTCCACTGG + Intronic
1022049676 7:26653680-26653702 ACCTGTAAGCCCCACTCCACTGG - Intergenic
1024606260 7:51024918-51024940 AGATGAAGGCTCCAGTCCACAGG - Intronic
1027617421 7:80440790-80440812 AACTGCCTGCTCAACTCTACTGG + Intronic
1028446560 7:90930793-90930815 ACCTGCACTCTCTACTCCACAGG - Intronic
1029814260 7:103076977-103076999 AGCTGCAGCCTCCACTTCCCTGG + Intronic
1030125695 7:106150739-106150761 AACTCATTGCTCCACTCCACTGG - Intergenic
1030386097 7:108870236-108870258 ACCTGCATGCTGCATCCCACAGG - Intergenic
1032414696 7:131727165-131727187 AGCTCCATTGTCCACTCCTCTGG + Intergenic
1033186647 7:139232113-139232135 CGCTGCTTTCTCCACTCCCCAGG + Intronic
1033437165 7:141343623-141343645 CACTGCAAGCTCCACCCCACCGG + Intronic
1034915883 7:155038660-155038682 AGCTGCAGCCTCCACTTCCCGGG + Intergenic
1036599316 8:10245405-10245427 AGCTAAATGGTGCACTCCACAGG - Intronic
1037742582 8:21619336-21619358 CGCTGCAAGCTCCACCCCCCAGG - Intergenic
1041444081 8:57931145-57931167 AGCTGCTTGGCCCACTCCAGAGG - Intergenic
1042737334 8:72004253-72004275 AGCTGCTTCCTCCTCACCACTGG - Intronic
1043324625 8:79034432-79034454 AGCAGTCTGCTCCACTCCACAGG - Intergenic
1044423623 8:92026744-92026766 AACTGCAAGCTCCACCTCACGGG - Intronic
1048591007 8:135820788-135820810 TTCTGCATGCTCCTCTCCAAAGG - Intergenic
1048995959 8:139793934-139793956 AGCTCCCAGCTCCACCCCACTGG + Intronic
1049706265 8:144044375-144044397 CACTGCAAGCTCCACGCCACGGG + Intronic
1050990743 9:12149007-12149029 ACCTGCATGCTCCCTTCCACAGG - Intergenic
1053423833 9:37998182-37998204 AGCTGCCTGCTCCCGGCCACTGG - Intronic
1054771784 9:69090292-69090314 AGCTGCATCCTTGACTCCACTGG + Intronic
1056099889 9:83291277-83291299 ACCTGCATGCTCCTTTCCAGAGG - Intronic
1056294155 9:85174709-85174731 AACTTCATGTTCCACTACACTGG - Intergenic
1056765731 9:89443443-89443465 AGCTGAAGGCTCCACTCTGCAGG - Intronic
1056937411 9:90926867-90926889 ACCTGGATGCTGGACTCCACAGG + Intergenic
1057918824 9:99079537-99079559 TGCTCCATCCTCCTCTCCACTGG - Intergenic
1185592318 X:1285617-1285639 AGCTGCAAGCTCCACCACCCGGG - Intronic
1186945286 X:14559489-14559511 GGCTGCAACCTCCACCCCACTGG + Intronic
1187231319 X:17426075-17426097 AGCTGGATCCTCCACACCACTGG - Intronic
1190724625 X:53180800-53180822 CGCTGCAGGCTCCACCCCCCGGG + Intergenic
1192175699 X:68883888-68883910 AGCCCCATGCTCCCCTCCCCTGG + Intergenic
1195540664 X:106059040-106059062 ACCTACATGCTCCTCTGCACTGG + Intergenic
1197099622 X:122637047-122637069 AGCTGCAAGCTGCACTGCTCAGG + Intergenic