ID: 1143922304

View in Genome Browser
Species Human (GRCh38)
Location 17:10340131-10340153
Sequence AAGATCTGCTGGTACTCACC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 74}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143922298_1143922304 30 Left 1143922298 17:10340078-10340100 CCACAGAATTTTGCATTTATCTC 0: 1
1: 0
2: 5
3: 52
4: 412
Right 1143922304 17:10340131-10340153 AAGATCTGCTGGTACTCACCAGG 0: 1
1: 0
2: 1
3: 4
4: 74
1143922302_1143922304 0 Left 1143922302 17:10340108-10340130 CCTGTTCTGTTCAAATACTTGGC 0: 1
1: 0
2: 0
3: 4
4: 127
Right 1143922304 17:10340131-10340153 AAGATCTGCTGGTACTCACCAGG 0: 1
1: 0
2: 1
3: 4
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143922304 Original CRISPR AAGATCTGCTGGTACTCACC AGG Exonic
904191517 1:28747828-28747850 AAGAACTGCTGGCACTGGCCGGG + Intronic
914513241 1:148352732-148352754 TGGATCTGCTGGTCCTCCCCAGG + Intergenic
916928070 1:169544217-169544239 AAGGTCTGCTGCAACTCTCCAGG - Intronic
920129894 1:203723985-203724007 AGGGTGTGCCGGTACTCACCTGG - Exonic
923811262 1:237319847-237319869 CAGATCTGCTAGCACACACCTGG - Intronic
924715872 1:246573595-246573617 AAGCTCTGTTGGCATTCACCGGG - Intronic
1063555632 10:7076259-7076281 AAGACCAGCTGTTACTCAACAGG + Intergenic
1066530797 10:36336841-36336863 ATGATGTGCTGGTACTCTCCGGG + Intergenic
1071532002 10:86397327-86397349 ACAAACTGCTGGTTCTCACCCGG - Intergenic
1076482580 10:130794438-130794460 AAGATCTGCTGTTAGTGAGCTGG + Intergenic
1085461305 11:76695530-76695552 AAGACCTGCTGGAGCTCACTGGG - Intergenic
1086506130 11:87506602-87506624 AAGATCTGCTGTTAGTCAGACGG + Intergenic
1089790822 11:120942295-120942317 TACATCTGTTGGTACTCACTAGG + Intronic
1098216655 12:68227639-68227661 AAGTTTTGTTGGTACACACCAGG - Intergenic
1107115950 13:36745621-36745643 AAGAGCTGCTGCAACTCTCCAGG + Intergenic
1107675235 13:42789302-42789324 AAGCTCTTCTAGTTCTCACCTGG + Exonic
1110066615 13:71114901-71114923 AACAACTGGTGGTATTCACCTGG + Intergenic
1110167549 13:72461289-72461311 AAGAGCTGCTGGATCTCACTAGG - Intergenic
1110197234 13:72804429-72804451 ATGATCTGATGGTAATCAACTGG + Intronic
1114424117 14:22608271-22608293 GAGATCTGATGGTACTAAACAGG + Intronic
1117013235 14:51491882-51491904 AAGGTCTGCTGGAAACCACCAGG + Intronic
1117403776 14:55381943-55381965 AGGATATGCTGCTTCTCACCAGG + Exonic
1119930400 14:78540980-78541002 GAGATCTGCTGTTACTCTCATGG + Intronic
1128183276 15:65623638-65623660 AAGATCTGCCAGTACTCTTCAGG - Intronic
1131504936 15:93009218-93009240 AAGAACAGCTGGAACACACCCGG + Exonic
1131646281 15:94348530-94348552 AACGTCTCCTGGTTCTCACCTGG - Intronic
1133002006 16:2856503-2856525 ACTCTCTGCTGGTCCTCACCTGG + Intronic
1134511909 16:14855208-14855230 AAGCTCTGCCAGTTCTCACCTGG - Intronic
1134699551 16:16253707-16253729 AAGCTCTGCCAGTTCTCACCTGG - Intronic
1134972277 16:18540964-18540986 AAGCTCTGCCAGTTCTCACCTGG + Intronic
1136244510 16:28966219-28966241 AAGTCCAGCTGGTACACACCGGG + Exonic
1138418595 16:56885370-56885392 CAGAGCTGCTGGGACCCACCTGG + Intronic
1142220170 16:88850371-88850393 CGGATCTGCTTGTGCTCACCTGG + Intronic
1143922304 17:10340131-10340153 AAGATCTGCTGGTACTCACCAGG + Exonic
1144175720 17:12705190-12705212 AAGAGATGCAGGTACTCACGTGG - Exonic
1150132848 17:62678636-62678658 AAGATCTTCGGGTACTGAGCCGG + Exonic
1158267502 18:55676613-55676635 AAGATCTGCTGGTTTTAAACAGG - Intergenic
1158862097 18:61602693-61602715 GTGATCTGCTGGTACTAAACTGG - Intergenic
1167834156 19:52052733-52052755 GAGATCTGCTGTTAGTCACATGG - Intronic
939225572 2:139359614-139359636 AAAATCAGCTGGTACTCATGAGG - Intergenic
939280939 2:140064066-140064088 AAGATCTGCTAATACCCACTGGG - Intergenic
940800335 2:158126019-158126041 AAGAACTGCTGGTCATCACCCGG - Intronic
945025381 2:205615452-205615474 AGGATCTGCGGGTCCTCCCCTGG - Exonic
945337398 2:208608820-208608842 AGGAACTGCTGGTGCCCACCAGG + Intronic
947239213 2:227976243-227976265 AAGTTCTGCTGGTAATGTCCTGG + Intergenic
947670901 2:231934749-231934771 CAGGACTGCTGGGACTCACCTGG + Intergenic
948060727 2:235041811-235041833 GAGATCTGCTGGGTCTCCCCAGG - Exonic
948829199 2:240589533-240589555 AAGGCCTCCTGGTACTCAGCAGG - Intronic
1177188403 21:17822684-17822706 AACACCTGCTGGAACTCACAGGG - Intergenic
1177801998 21:25836975-25836997 AAGAACTGCTGGCACTCACCAGG - Intergenic
1183273426 22:36876073-36876095 AAGACCTGCTGGAGCTCACAAGG + Exonic
951745116 3:25969912-25969934 AACATTGGCTGGTACTCACTTGG + Intergenic
957490143 3:80914943-80914965 AAGATTTTCTGCTACTCATCTGG - Intergenic
959823654 3:110767471-110767493 AAGCTCTGTTGGTGCTCACTGGG + Intergenic
962134803 3:132722376-132722398 CAGTCCTGCTGGTACTCACTAGG - Exonic
965675216 3:171187720-171187742 GAGGTCTGCAGGTGCTCACCGGG - Intronic
970446448 4:16126767-16126789 ATGATCTTCTGGGACTCAGCTGG + Intergenic
979133199 4:117075160-117075182 AAGAACTGCTGGGACCCACTTGG - Intergenic
982173203 4:152681489-152681511 AAGACCTGCTGGTACTGAGTTGG + Intergenic
983938637 4:173520324-173520346 AAGATCAGAGGGTACTCACCAGG - Intergenic
986020569 5:3797473-3797495 AATATCTGCAGGTACTGATCTGG + Intergenic
994207340 5:97050197-97050219 AAGATCTGCTGGTCTTCATTTGG - Intergenic
1011745007 6:90400753-90400775 AAAATCTGGTGGCAGTCACCTGG + Intergenic
1013619065 6:111872153-111872175 GAGATGTGCTGGGACTCACTGGG - Intronic
1022210099 7:28200112-28200134 AAGTGATGCTGGTACCCACCAGG + Intergenic
1026799373 7:73389583-73389605 AGGATCTGCTTAAACTCACCTGG - Intergenic
1027969216 7:85057097-85057119 TAGATCTGTAGGTACTGACCTGG + Intronic
1029044467 7:97613460-97613482 GAGATCTGCGGATAGTCACCTGG - Intergenic
1036642556 8:10593272-10593294 AAGGTCTCCTGGTCCCCACCCGG - Intergenic
1037063719 8:14549077-14549099 AAGATATGCTGGTAATTAACAGG - Intronic
1039002235 8:32994807-32994829 AAGATCTGGTGGTGGTCACAGGG - Intergenic
1041350425 8:56942782-56942804 AAGGGCTGCTGGTGCTCTCCAGG + Intergenic
1044908442 8:97030281-97030303 AAGATCTGCTTCTTCTCATCTGG - Intronic
1049861120 8:144900308-144900330 AAAATCTGCGAGTACCCACCCGG + Intronic
1052846823 9:33344185-33344207 AAGACAAGTTGGTACTCACCTGG - Exonic
1060749539 9:126159863-126159885 CACATGTTCTGGTACTCACCAGG + Intergenic
1061922736 9:133791116-133791138 AGGATCTGCTGGTTCTAACCTGG - Intronic
1186149757 X:6661765-6661787 AAGTTCAGCTGTTCCTCACCTGG + Intergenic
1188158462 X:26771181-26771203 AAAATCTGTTTGTACTCACTTGG + Intergenic
1201372151 Y:13277657-13277679 AAATTCTGCTGGTACCCACTGGG + Intronic