ID: 1143924118

View in Genome Browser
Species Human (GRCh38)
Location 17:10354688-10354710
Sequence CGATGACAGTGAAGAACTGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 103}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143924118_1143924120 4 Left 1143924118 17:10354688-10354710 CCAGCAGTTCTTCACTGTCATCG 0: 1
1: 0
2: 0
3: 11
4: 103
Right 1143924120 17:10354715-10354737 TGGCTACCGTGACCTCTCCTTGG 0: 1
1: 0
2: 2
3: 6
4: 84
1143924118_1143924122 14 Left 1143924118 17:10354688-10354710 CCAGCAGTTCTTCACTGTCATCG 0: 1
1: 0
2: 0
3: 11
4: 103
Right 1143924122 17:10354725-10354747 GACCTCTCCTTGGCTCACGAAGG 0: 1
1: 0
2: 0
3: 8
4: 91
1143924118_1143924123 15 Left 1143924118 17:10354688-10354710 CCAGCAGTTCTTCACTGTCATCG 0: 1
1: 0
2: 0
3: 11
4: 103
Right 1143924123 17:10354726-10354748 ACCTCTCCTTGGCTCACGAAGGG 0: 1
1: 0
2: 0
3: 7
4: 115
1143924118_1143924125 16 Left 1143924118 17:10354688-10354710 CCAGCAGTTCTTCACTGTCATCG 0: 1
1: 0
2: 0
3: 11
4: 103
Right 1143924125 17:10354727-10354749 CCTCTCCTTGGCTCACGAAGGGG 0: 1
1: 0
2: 0
3: 13
4: 126
1143924118_1143924127 26 Left 1143924118 17:10354688-10354710 CCAGCAGTTCTTCACTGTCATCG 0: 1
1: 0
2: 0
3: 11
4: 103
Right 1143924127 17:10354737-10354759 GCTCACGAAGGGGAAGTCGAAGG 0: 1
1: 0
2: 1
3: 5
4: 76
1143924118_1143924129 28 Left 1143924118 17:10354688-10354710 CCAGCAGTTCTTCACTGTCATCG 0: 1
1: 0
2: 0
3: 11
4: 103
Right 1143924129 17:10354739-10354761 TCACGAAGGGGAAGTCGAAGGGG 0: 1
1: 0
2: 1
3: 5
4: 125
1143924118_1143924128 27 Left 1143924118 17:10354688-10354710 CCAGCAGTTCTTCACTGTCATCG 0: 1
1: 0
2: 0
3: 11
4: 103
Right 1143924128 17:10354738-10354760 CTCACGAAGGGGAAGTCGAAGGG 0: 1
1: 0
2: 0
3: 9
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143924118 Original CRISPR CGATGACAGTGAAGAACTGC TGG (reversed) Exonic
904169325 1:28580567-28580589 TAATGACAGTGATGAAATGCAGG - Intergenic
904431060 1:30464679-30464701 CGATGAAAGTGAAGATGGGCCGG + Intergenic
908234347 1:62135554-62135576 TGAAGACAGTGATAAACTGCAGG + Intronic
908375461 1:63534101-63534123 TGCTGACAGTAAAGAACTCCTGG - Exonic
910303900 1:85739942-85739964 CGATGAAAGTGAAGAATTATTGG - Intronic
913446974 1:118960393-118960415 CAAGGGCAGTGAAGAGCTGCAGG - Intronic
913527078 1:119703759-119703781 TGATGCCAGTAAAGAGCTGCTGG - Intronic
920966462 1:210705307-210705329 AGCTGGCAGAGAAGAACTGCAGG + Intronic
922633461 1:227138933-227138955 CGGTGGCAGTGAAGAAATACTGG + Intronic
922932148 1:229398317-229398339 AGAGGACAGTGAAGGACTTCTGG - Intergenic
1066319445 10:34286777-34286799 GGATGCATGTGAAGAACTGCAGG + Intronic
1067153907 10:43758847-43758869 TGTTGACTGTGAAGAACTGCTGG - Intergenic
1070372352 10:75794514-75794536 CAATCACAGTGAAAAACTGTTGG - Intronic
1074832229 10:117256936-117256958 CGATGACAGTCCAGGAGTGCTGG - Intronic
1076090160 10:127678703-127678725 GGATGGAAGCGAAGAACTGCAGG + Intergenic
1077137838 11:1010153-1010175 CGGTGACAGAGAGGAACAGCTGG - Intronic
1082978808 11:59101954-59101976 CGCTGACAGCGGAGAGCTGCCGG - Intergenic
1084439215 11:69161685-69161707 CGGAGACAGTGAAGAATTGATGG + Intergenic
1088640919 11:111872045-111872067 CGATGACAGTGATGGACATCTGG - Intergenic
1089650465 11:119909570-119909592 TGATGAGAGTTAAGAACTGAGGG - Intergenic
1096197889 12:49660600-49660622 GGATGACACTGAAGACCTGCTGG + Intronic
1098354437 12:69598351-69598373 CTATGACAGTGCAGACCTGGTGG + Exonic
1106457825 13:29943058-29943080 GGGAGACAGTGAAGAACTTCAGG - Intergenic
1107034344 13:35884792-35884814 AGATGATAGTCAAGAACTCCAGG + Intronic
1112114852 13:96340595-96340617 CCAAGACACTGAAGAACTGGAGG + Intronic
1113108490 13:106797061-106797083 CGATAGAAATGAAGAACTGCAGG - Intergenic
1115847197 14:37552463-37552485 CTATACCAGTGAAGAACTGTTGG + Intergenic
1116118650 14:40693374-40693396 CCATGACAGTGAGAAACTGCTGG - Intergenic
1117666920 14:58065794-58065816 CAATGACAGAGAAAATCTGCTGG - Intronic
1118505442 14:66405803-66405825 CCATGACAGAGTATAACTGCAGG + Intergenic
1118550770 14:66947331-66947353 CAATGATAGAGAATAACTGCAGG - Intronic
1122899552 14:104776693-104776715 CGATGACAGTGGTCCACTGCAGG + Exonic
1123980248 15:25595641-25595663 CAATGAGAGTGAAGAATTACAGG - Intergenic
1129721676 15:77881184-77881206 CGATGCCAGGGAAGAAGTGTGGG - Intergenic
1130843009 15:87719339-87719361 TGAAGACAATGAAGAAGTGCTGG - Intergenic
1136576333 16:31127470-31127492 CGAGTACAGGGAAGAGCTGCTGG + Intronic
1137807075 16:51317363-51317385 CAATGTCAGTAAAGAAATGCAGG - Intergenic
1139456145 16:67078958-67078980 CGATGACAGGAAAAAACTGTGGG - Intronic
1141464945 16:84199201-84199223 CTATTACAGGGAAGAGCTGCAGG + Intergenic
1143924118 17:10354688-10354710 CGATGACAGTGAAGAACTGCTGG - Exonic
1143924200 17:10355507-10355529 CAATGACAGTGAAGAATTGTTGG - Intronic
1144183533 17:12774688-12774710 GGAAGACCGGGAAGAACTGCTGG + Intergenic
1150470559 17:65433689-65433711 GGCTAACAGTGAAGAACTCCAGG - Intergenic
1150833037 17:68540876-68540898 CGATGACATTGAGGAGCCGCTGG + Exonic
1152097776 17:78281878-78281900 CTCTTACAGTGAAGAACTGCTGG - Intergenic
1152449452 17:80367733-80367755 CGAAGACACTGAAGAAAGGCAGG - Exonic
1154350410 18:13578437-13578459 CGATGACAATGATGATGTGCTGG - Intronic
1158457488 18:57621360-57621382 CGATCACTTTGAAGAACTGCAGG + Intronic
1160628420 18:80228780-80228802 TGAGAACAGTGAACAACTGCAGG + Intronic
1162778311 19:12993545-12993567 CGGGGACACTGAAGAAATGCAGG - Intergenic
1163403885 19:17110729-17110751 CGGTGACAGTGATGGGCTGCAGG + Intronic
1164257103 19:23537709-23537731 CCATGACTGTGAAGCATTGCAGG - Intronic
1165521178 19:36315322-36315344 CCAGGTCAGTGAAGAACAGCCGG + Intergenic
1165622889 19:37263268-37263290 CCAGGTCAGTGAAGAACAGCCGG - Intergenic
1167208915 19:48121181-48121203 CGAGGACAGTGAGGAGCTGCAGG - Exonic
1168243052 19:55096753-55096775 CGAAGACGGTGGTGAACTGCGGG - Intronic
1168243084 19:55096879-55096901 CGAAGACGGTGGTGAACTGCGGG - Intronic
1168243092 19:55096909-55096931 CGAAGACGGTGGTGAACTGCGGG - Intronic
1168243100 19:55096939-55096961 CGAAGACAGTGGTGAACTGCAGG - Intronic
1168243187 19:55097331-55097353 CGAAGACGGTGGTGAACTGCAGG - Intronic
1168243208 19:55097418-55097440 CGAAGACGGTGGTGAACTGCGGG - Intronic
1168243260 19:55097647-55097669 CGAAGACGGTGGTGAACTGCGGG - Intronic
925262702 2:2542367-2542389 CCATGACACAGGAGAACTGCTGG - Intergenic
928681799 2:33710491-33710513 AGAAGAGAGTCAAGAACTGCAGG + Intergenic
929542863 2:42835722-42835744 CGATGACAGTGCTGATCTACAGG + Intergenic
929953303 2:46434218-46434240 AGATGACAGTGTAGAACAACAGG + Intronic
932189760 2:69730912-69730934 TGATGACAGGGAAGTGCTGCTGG + Intronic
935185233 2:100725602-100725624 CCAAGACAGTGGAGCACTGCAGG + Intergenic
935460909 2:103332542-103332564 GCATGACAGTGAACAACTCCTGG - Intergenic
935877968 2:107533255-107533277 CGATGTCAGTGAAATAGTGCAGG - Intergenic
936772660 2:115933513-115933535 TGATGAGAGTTAAAAACTGCAGG - Intergenic
940029370 2:149244776-149244798 GCTTGATAGTGAAGAACTGCTGG - Intergenic
940187508 2:151003411-151003433 GGATGACAGTGAGAAACTCCTGG + Intronic
942597972 2:177610161-177610183 AGATGACAGTGAAGGAATTCAGG + Intergenic
948606929 2:239141696-239141718 CCATTACAGGGAAGATCTGCTGG - Intronic
948886741 2:240888588-240888610 CGAGGACTGGGCAGAACTGCAGG - Exonic
949043710 2:241860735-241860757 GGGTGACAGGGAAGAACTGCAGG - Intergenic
1170869234 20:20189571-20189593 GGATGACGGTGAAGAACACCAGG - Intronic
1175092697 20:56518151-56518173 CGCTGACAGTGAAGAATCGGAGG + Exonic
1175407044 20:58741651-58741673 GGATGACACTGATGACCTGCAGG + Intergenic
1181019997 22:20094774-20094796 CAAAGACAGTGAAGAACTCGAGG + Exonic
1181448128 22:22994838-22994860 TGATGACATTGATGCACTGCAGG + Intergenic
1184854379 22:47138427-47138449 CGTGGACAGTGATGACCTGCAGG + Intronic
1184897653 22:47420992-47421014 CGAGGAAAGTGAAGACCTGAGGG - Intergenic
966431026 3:179831849-179831871 CGATGCCAGTGTAGACCTGAAGG + Intronic
968814162 4:2813041-2813063 CTATGCCAGAGAAGCACTGCTGG - Intronic
973029970 4:45325345-45325367 TGATGACTGTCAAGCACTGCTGG - Intergenic
983772825 4:171571857-171571879 GGCTGACAGTGGACAACTGCAGG + Intergenic
987114587 5:14715942-14715964 CAAAGACAGAGAAGGACTGCTGG - Intronic
988878070 5:35470292-35470314 TGATGACATTTATGAACTGCTGG - Intergenic
990667281 5:58087379-58087401 TGAGGACAGTGGAGAACAGCTGG + Intergenic
991684400 5:69168036-69168058 CAAAGTCAGTGAACAACTGCAGG + Exonic
992226799 5:74626490-74626512 AAATGACAGGGAAGAACGGCGGG - Intergenic
997695304 5:135856661-135856683 AGATGAAGGTGAAGAACTGCCGG - Intronic
999361952 5:150992832-150992854 AGAGGACTGTGAAGAGCTGCAGG - Intergenic
999841406 5:155431533-155431555 CCATGTCAGGGAAGAACTGTTGG + Intergenic
1000097871 5:157986938-157986960 TAATCTCAGTGAAGAACTGCCGG + Intergenic
1001688705 5:173616271-173616293 CGATGAGAGCGATGAGCTGCGGG + Exonic
1009844488 6:69119095-69119117 CCATGACAGTGAAAAACTGGAGG - Intronic
1010761643 6:79730525-79730547 CTATGGCAGTGTAGAACTGGAGG + Intergenic
1010806584 6:80244172-80244194 AGATGAAAGTGAAGAAAGGCTGG + Intronic
1013050538 6:106530244-106530266 TGATGATACTGAAGAAATGCAGG + Exonic
1013055999 6:106583339-106583361 AGATGACATTGCAGAACTGGTGG - Exonic
1017278342 6:152595988-152596010 CCATCACAGTGGAGAACTGAGGG + Intronic
1024134252 7:46390400-46390422 CAAACACAGTGAAAAACTGCAGG + Intergenic
1029169854 7:98622765-98622787 CGATGCCACTGCAGAGCTGCTGG - Intronic
1034197003 7:149255686-149255708 TGATGACAGGGAAGGACTGATGG + Intergenic
1034241623 7:149615791-149615813 CGATGACAGGAAAGGCCTGCAGG + Intergenic
1038949873 8:32402535-32402557 CATAGACAGTGAGGAACTGCTGG - Intronic
1039651715 8:39348085-39348107 CTATGAGAGTTAAGAACTCCAGG + Intergenic
1039926783 8:41941120-41941142 CACTGAAAGTGAAGAACAGCTGG - Exonic
1047339123 8:123963285-123963307 AGGTGACACTGAAGCACTGCAGG + Exonic
1049016543 8:139924087-139924109 GGGTGACAGAGAAGAACTCCAGG + Intronic
1050557879 9:6805732-6805754 CGATGACTGTGAAGGAGTTCAGG + Exonic
1057260470 9:93580201-93580223 CGGTGCCAGTGAAGAAGGGCTGG - Intronic