ID: 1143924121

View in Genome Browser
Species Human (GRCh38)
Location 17:10354721-10354743
Sequence CGTGAGCCAAGGAGAGGTCA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 4, 3: 22, 4: 195}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143924121_1143924127 -7 Left 1143924121 17:10354721-10354743 CCGTGACCTCTCCTTGGCTCACG 0: 1
1: 0
2: 4
3: 22
4: 195
Right 1143924127 17:10354737-10354759 GCTCACGAAGGGGAAGTCGAAGG 0: 1
1: 0
2: 1
3: 5
4: 76
1143924121_1143924131 2 Left 1143924121 17:10354721-10354743 CCGTGACCTCTCCTTGGCTCACG 0: 1
1: 0
2: 4
3: 22
4: 195
Right 1143924131 17:10354746-10354768 GGGGAAGTCGAAGGGGTTGGTGG 0: 1
1: 0
2: 2
3: 186
4: 965
1143924121_1143924129 -5 Left 1143924121 17:10354721-10354743 CCGTGACCTCTCCTTGGCTCACG 0: 1
1: 0
2: 4
3: 22
4: 195
Right 1143924129 17:10354739-10354761 TCACGAAGGGGAAGTCGAAGGGG 0: 1
1: 0
2: 1
3: 5
4: 125
1143924121_1143924132 16 Left 1143924121 17:10354721-10354743 CCGTGACCTCTCCTTGGCTCACG 0: 1
1: 0
2: 4
3: 22
4: 195
Right 1143924132 17:10354760-10354782 GGTTGGTGGAGATCAGAAGCAGG 0: 1
1: 0
2: 1
3: 23
4: 237
1143924121_1143924130 -1 Left 1143924121 17:10354721-10354743 CCGTGACCTCTCCTTGGCTCACG 0: 1
1: 0
2: 4
3: 22
4: 195
Right 1143924130 17:10354743-10354765 GAAGGGGAAGTCGAAGGGGTTGG 0: 1
1: 0
2: 13
3: 307
4: 1129
1143924121_1143924128 -6 Left 1143924121 17:10354721-10354743 CCGTGACCTCTCCTTGGCTCACG 0: 1
1: 0
2: 4
3: 22
4: 195
Right 1143924128 17:10354738-10354760 CTCACGAAGGGGAAGTCGAAGGG 0: 1
1: 0
2: 0
3: 9
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143924121 Original CRISPR CGTGAGCCAAGGAGAGGTCA CGG (reversed) Exonic
900421746 1:2558759-2558781 CGTGGGCACAGGAGAGGTCTGGG - Intronic
900760725 1:4468439-4468461 TGTGAGCCAAGGAGAGACCTCGG + Intergenic
902898740 1:19498574-19498596 CTTGAGCCCAGTTGAGGTCAAGG - Intergenic
903745056 1:25581306-25581328 CTTGAGCCAGGGAGAGGAGAGGG + Intergenic
903941123 1:26932088-26932110 CCTGAGCCTTGGGGAGGTCAAGG - Intronic
906413030 1:45594586-45594608 CCTGAGCCCAGGGAAGGTCAAGG - Intronic
907718571 1:56950706-56950728 ACTGAGGCATGGAGAGGTCAAGG - Intronic
909653060 1:77997422-77997444 GCTGAGCCCAGGAGAGATCATGG + Intronic
910625819 1:89305356-89305378 AGTGAGACAAGTTGAGGTCATGG + Intergenic
911397598 1:97331394-97331416 CTTGAGCCCAGGAGAGTTCGAGG + Intronic
914887359 1:151596350-151596372 CCTGGGCCACGGAGGGGTCATGG + Intergenic
915234458 1:154470220-154470242 CGTGGGCCATGGAGGGGGCACGG + Intronic
915359394 1:155277274-155277296 CCTGAGCCAGGGAGAGGGCGTGG - Intronic
915949172 1:160176481-160176503 CATAAGCCAAGGAGATGGCAGGG - Exonic
919863027 1:201755335-201755357 CCTGAGGCAAGAGGAGGTCAAGG + Intronic
920104870 1:203545190-203545212 CTTGAGCCAAAGAAAGGGCATGG + Intergenic
921670158 1:217916145-217916167 AGTGAGCCATGGGGAGCTCAGGG - Intergenic
924094884 1:240541033-240541055 TGTGAGCCAAAGAGAAGGCAGGG - Intronic
924643962 1:245859975-245859997 CATGAGCCAGGGAGAGTTCCAGG + Intronic
924815852 1:247441320-247441342 CTTGAGCCCAGGAGAGTTCAAGG - Intronic
1064167957 10:13002469-13002491 CCTGAGCCCAGGGGAGGTCGAGG - Intronic
1066401516 10:35081140-35081162 CTTGAGCAAAGGAGACTTCAAGG + Intronic
1067098080 10:43315388-43315410 AGAAAGCCAAGGAGAGTTCATGG + Intergenic
1069950088 10:72012603-72012625 CCTGAGGCAAGGAGAGCTAAGGG + Exonic
1070141899 10:73744469-73744491 GGAAAGCAAAGGAGAGGTCAGGG + Intronic
1070379876 10:75871188-75871210 GGTGAGCCAAGGAGATGTAATGG - Intronic
1070971139 10:80568312-80568334 CTTGAGTGAAGGAGAGGGCAAGG + Intronic
1071354975 10:84784827-84784849 CCTGGGCCAAGGAGAGAACAGGG - Intergenic
1072795980 10:98354879-98354901 GGTGAGGAAAGGAGAGGTCATGG + Intergenic
1073310009 10:102533634-102533656 CGTGAGCTAAGGAATGGACATGG - Intronic
1077572400 11:3351445-3351467 CGTGAGCCTGGGAGATCTCAAGG - Intronic
1078204216 11:9213833-9213855 AGTGAGCCAGGGAGGGGACAAGG + Intronic
1079245424 11:18748987-18749009 AGTGAGTAAAGGAGAGGGCAGGG - Intronic
1079298551 11:19256889-19256911 CATGAGGGAAGGAGAGGACAAGG - Intergenic
1080686054 11:34515699-34515721 CGTGAGACAAACAGAGTTCATGG - Intergenic
1082840276 11:57684053-57684075 CCTGAGCCAGGGGGGGGTCAAGG - Intronic
1083274871 11:61591199-61591221 CCTCAGCTAAGGACAGGTCATGG - Intergenic
1083947222 11:65930909-65930931 CAAGAGCCACTGAGAGGTCAAGG - Intergenic
1084070548 11:66730698-66730720 CGTGACCCAATTAGAAGTCAAGG + Intergenic
1084394784 11:68902122-68902144 AGTGAGCAAAGGAGACGTGATGG - Intronic
1087030720 11:93701658-93701680 AGTGAGCCAAGATGACGTCACGG - Intronic
1087843285 11:102942362-102942384 CACGAGGCAGGGAGAGGTCAAGG - Intergenic
1089319912 11:117618760-117618782 AGTGGGCCAAGGAGAGCACAGGG + Intronic
1089729331 11:120511000-120511022 CCTGAGGCTAGGAGAGGTGAAGG - Intergenic
1091395579 12:152423-152445 AGAGAGCCAGGGAGAGGTGAGGG + Intronic
1092090027 12:5796873-5796895 TGTGAGCCATTGAGAGCTCATGG - Intronic
1092230486 12:6773166-6773188 GGTGAGCAAAAGAGAGGCCAAGG - Intronic
1092951562 12:13508338-13508360 CGTCGGCCAAGGGGAGGGCAAGG - Intergenic
1094065720 12:26358893-26358915 AGTGAACCATGGAGAGGTCTAGG - Intronic
1096600654 12:52726242-52726264 CTTGAGGCCAGGAGAGCTCAGGG - Intergenic
1096804413 12:54131711-54131733 GGTGAGCCAAGGGGATGTGAAGG - Intergenic
1097034030 12:56110456-56110478 CGTCAGCTCAGGAGAGGGCAAGG + Exonic
1097298111 12:57989114-57989136 GGTGAGCAAAGGAGGGGTAATGG + Intergenic
1098230985 12:68371413-68371435 AGAGAGCCAAGGACAGGACAAGG + Intergenic
1102348498 12:112174934-112174956 CGTGAGCCAGAGGGAGGGCAGGG + Intronic
1103635692 12:122303366-122303388 TGTGAGCCAAGGGAAGGTCTAGG - Intronic
1104074010 12:125373463-125373485 TGCAAGCCAAGGAGAGGTCTCGG + Intronic
1106628266 13:31442844-31442866 CGTGAGACCAGCTGAGGTCAAGG + Intergenic
1111667527 13:91288089-91288111 CCTGAGCCCAGGGGAGGTCGAGG - Intergenic
1111947683 13:94682710-94682732 AGTCAGCCATGGAAAGGTCATGG + Intergenic
1113126153 13:106981740-106981762 TGTGAGCCTGGGAGAGGCCAGGG - Intergenic
1113788077 13:113013343-113013365 CCAGAGCCAAGCAGATGTCAAGG - Intronic
1121449904 14:94000639-94000661 ACTGAGCCAAGGAGGAGTCAGGG + Intergenic
1121791599 14:96703440-96703462 TGAGAGCCAAGCAAAGGTCATGG - Intergenic
1126352571 15:47759776-47759798 GGTGGGCCAAGGTGAAGTCAGGG - Exonic
1126411073 15:48373730-48373752 TGTGAGACAAGGCGAGGTGAAGG + Intergenic
1128347843 15:66865823-66865845 CATTAGCCAAGGAGATGTGAGGG - Intergenic
1130941961 15:88518018-88518040 CTTGAGCCCAGGAGAGGTGGAGG - Intronic
1131166773 15:90147602-90147624 CCTGAGCCTAGGGGAGGTCAAGG - Intergenic
1132569798 16:639068-639090 CATTCTCCAAGGAGAGGTCAGGG - Intronic
1132610869 16:815707-815729 CTAGAGCCCAGGAGAGGTCAAGG - Intergenic
1132966185 16:2656038-2656060 CTTGAGCCCAGGGGAGTTCAAGG + Intergenic
1135399830 16:22158877-22158899 CCTGAGCCCAGGAGAGGTTGAGG + Intergenic
1136021850 16:27445510-27445532 ACTGAGGCAAGGAGATGTCAAGG + Intronic
1137864602 16:51880275-51880297 CGTGAGTCAATCAGTGGTCATGG + Intergenic
1138761719 16:59552347-59552369 CTTTGGCCAAGGATAGGTCAAGG + Intergenic
1140454152 16:75095036-75095058 CATGAGCCTAGGAGGGATCATGG + Intronic
1140737163 16:77908599-77908621 CTTGAGCCACTGACAGGTCATGG - Intronic
1140904213 16:79396588-79396610 CTTGAGCCTCAGAGAGGTCATGG - Intergenic
1140930692 16:79624982-79625004 CGTAAGTCAAGGAGCCGTCAGGG - Intergenic
1141749842 16:85951108-85951130 AGTGAGACAAAGACAGGTCACGG + Intergenic
1141843450 16:86590197-86590219 GGTGAGCAAAGGAGAGGGCATGG + Intergenic
1141859711 16:86708324-86708346 AGTGAGCCCAGGTGAGTTCAGGG + Intergenic
1203124234 16_KI270728v1_random:1561145-1561167 TGTGGGCCAAGGTGGGGTCAGGG - Intergenic
1142708516 17:1710662-1710684 CGGGAGCCGGGAAGAGGTCAAGG - Intergenic
1143526207 17:7474297-7474319 CCTGAGCCTAGGGGAGGTCAAGG - Intronic
1143924121 17:10354721-10354743 CGTGAGCCAAGGAGAGGTCACGG - Exonic
1143924204 17:10355540-10355562 TCTGAGCCAAGGAGAGGTCATGG - Intronic
1143983876 17:10894559-10894581 GGTGAAGCAAGGGGAGGTCAGGG - Intergenic
1144183068 17:12770752-12770774 CGTAAGCCAAGGAGAGAGAACGG - Intergenic
1146003670 17:29147434-29147456 CCTGAGCCCAGGGAAGGTCAAGG + Intronic
1152066470 17:78115278-78115300 CGTCTGCCAAGGCGAGGGCAGGG - Intronic
1152357097 17:79812735-79812757 CGGGCGCCAAGGGGAGCTCAGGG - Intergenic
1158723933 18:59951045-59951067 CGTGAGCCTAGGAGAGATCAAGG + Intergenic
1158896272 18:61916592-61916614 TCTGAGCCAAGGTGAGGCCAGGG + Intergenic
1158963146 18:62602858-62602880 CGGGGGCCAGGGAGAGGTGAAGG + Intergenic
1159056232 18:63467170-63467192 CCTGAGCCATGGGGAGGCCAGGG - Intergenic
1161174328 19:2831679-2831701 CTTGAGCCCTGGGGAGGTCAAGG - Intronic
1162308114 19:9887980-9888002 TTTGAGACAAGGAGAGATCATGG - Intronic
1162561330 19:11419462-11419484 CGCCAGCCCAGGAGAGGTCCTGG + Intergenic
1165834407 19:38745465-38745487 CGTGAGCGGAGGGGAGCTCAGGG - Intronic
1166059831 19:40319417-40319439 AGACAGCCTAGGAGAGGTCAGGG - Intergenic
1166154682 19:40901985-40902007 TGTGGGCCAAGGTGAGGTCTTGG + Intergenic
1166364060 19:42269651-42269673 AGTGTGACAAGGAGAGGTGATGG + Intronic
1167495038 19:49812731-49812753 CGGGAGCTAAGGAGGGGTTAGGG + Exonic
927558591 2:24052887-24052909 CTTGAGCCCAGGAAAGGTCAAGG + Intronic
928090343 2:28369969-28369991 CCTGAGCTGAGGAGAGGACAGGG + Intergenic
928260078 2:29758601-29758623 AGGGAGCCAAGGAGAGGGCCAGG - Intronic
929046156 2:37792555-37792577 CTGGAGCCAAGGAGAGGTCACGG + Intergenic
931187801 2:59970761-59970783 CGTGAGCCACCGCGAGGTCTGGG - Intergenic
932577955 2:72973004-72973026 CCTGAGCCAACGAGTGGTCCAGG + Intronic
932934066 2:76080797-76080819 GGTGAGCCAAGGTGAGCCCAAGG - Intergenic
933470378 2:82715540-82715562 CCTGAGCCCAGGAGGGGTCGAGG - Intergenic
933656492 2:84891556-84891578 CGGGGGCCAAGTGGAGGTCACGG - Intronic
934684571 2:96311314-96311336 TTTGAGCCCAGAAGAGGTCAAGG - Intergenic
937582463 2:123503492-123503514 GGTGAGCCAGGGAGAGTCCAGGG - Intergenic
939520218 2:143221012-143221034 CGTGTTTCAAGCAGAGGTCAGGG - Intronic
942015153 2:171806027-171806049 CTTGAGCCCAGGAGTTGTCAAGG + Intronic
942276635 2:174328152-174328174 CGCGAGCCCAGGAGAGGACTTGG + Intergenic
944807667 2:203298304-203298326 CTTGAGACCAGGAGAGGTCAAGG + Intronic
946667632 2:222067460-222067482 CATGAGGTCAGGAGAGGTCAAGG - Intergenic
948661427 2:239508926-239508948 CCTCAGCCCAGGAGAGGCCAGGG - Intergenic
1168856608 20:1013423-1013445 CGTGGGCCAGGGGGAGGCCATGG - Intergenic
1170072142 20:12380747-12380769 CGTCAGCTCAGGAGAGGGCAAGG + Intergenic
1171225321 20:23437815-23437837 CCTGAGCCCAAGAGAGGTCGAGG - Intergenic
1172487227 20:35305574-35305596 CTAGAGCCAGGGAGAGGGCACGG - Intronic
1173569356 20:44066684-44066706 CATGAGCCAAGGAGAGATGAGGG - Intronic
1174323292 20:49759298-49759320 TTTTAGCCAATGAGAGGTCAGGG + Intergenic
1176042626 20:63073354-63073376 CGGGAGCCCAGGAGAGGGCCTGG + Intergenic
1176076173 20:63249187-63249209 GGTGAGGCGAGGACAGGTCACGG - Intronic
1176866356 21:14056958-14056980 CGAGGGCCAAGGTGGGGTCAGGG + Intergenic
1179453039 21:41478406-41478428 TGGGAGGCAAGGAGAGCTCATGG + Intronic
1179816064 21:43907113-43907135 CTTCAGCCCAGGAGAGCTCAAGG - Intronic
1180153913 21:45968175-45968197 CGTCAGCCAGTGAGAGGCCACGG - Intergenic
1180179833 21:46113052-46113074 CGTGTTACAAGGAGAGGTCGAGG + Intronic
1180549636 22:16529467-16529489 TGAGGGCCAAGGAGGGGTCAGGG - Intergenic
1181862905 22:25833286-25833308 CCTGAGCCAAAGTGAGTTCAGGG + Intronic
1182313901 22:29429905-29429927 GGTCACCCAAGGAGAGCTCAGGG + Intergenic
1184385720 22:44173420-44173442 CCTGTGCCAAGGAGAGTTTATGG - Intronic
1184494193 22:44827798-44827820 CTTGAGCCCAGGAGAGGGCCGGG + Intronic
1184647481 22:45903943-45903965 CCTGGGGCCAGGAGAGGTCAAGG - Intergenic
950200946 3:11043474-11043496 CATGAGCGAAGGAGAAATCAAGG + Intergenic
950783280 3:15410785-15410807 CTTGAGCCCAGGGGAGGTCGAGG + Intronic
951226493 3:20127101-20127123 CCAGTGCCAAGGAGGGGTCAGGG - Intronic
951686688 3:25352125-25352147 AGTGAACCAAGGCGAGGCCATGG + Intronic
952841686 3:37651982-37652004 TGTGAGGCATGGAGAGGTGAAGG - Intronic
954985004 3:54782723-54782745 TTTGAGACAAGGAGAGGTGATGG - Intronic
954995425 3:54876941-54876963 AGTGAGCCACAGAGAGGTCACGG + Intronic
955619735 3:60850014-60850036 CATGAGCCCAGGCGATGTCAGGG + Intronic
957860996 3:85948955-85948977 CGTGGGGCCAGGAGATGTCATGG + Intronic
957941860 3:87016518-87016540 AGTGAACCAAGGAGAGAACATGG - Intergenic
959832010 3:110875304-110875326 TGTAAGGCAAGGAGAGTTCACGG + Intergenic
961677956 3:128579078-128579100 AGTGAGACAAGGGGAGGTGAGGG + Intergenic
962914855 3:139891801-139891823 TTTGGGCCAAGGAGAGGTGAAGG + Intergenic
964888307 3:161509834-161509856 CCAGAGCAAAGGAGAGGTCAGGG - Intergenic
969407666 4:7004865-7004887 CCCGAGCCAAGGAGAGGTGGCGG + Exonic
970512219 4:16792709-16792731 CAGGAGCCGAGGAGAGGCCAGGG - Intronic
970583394 4:17493351-17493373 CTTGAGCCTGGGGGAGGTCAAGG + Intronic
971140920 4:23924041-23924063 CCTGTGCCCAGGAGAGGCCAGGG - Intergenic
976274393 4:83261413-83261435 TTTGAGCCACCGAGAGGTCAGGG + Intergenic
976274450 4:83261790-83261812 AGTGAGCCACAGAGAGGTCAGGG + Intronic
977453600 4:97228946-97228968 GGTGAGCCTAGGAATGGTCAGGG + Intronic
981736773 4:147961777-147961799 CGAGAGGTAAGGAGAGGTCAAGG - Intronic
985820616 5:2157604-2157626 CGGGATCGCAGGAGAGGTCATGG + Intergenic
985893449 5:2734393-2734415 CGTAAGTCAAGGAGACCTCAGGG + Intergenic
987201561 5:15582913-15582935 CATGAGCCAAGGAGAGGATTAGG - Intronic
988826083 5:34936657-34936679 AGAGAGACAAAGAGAGGTCATGG - Intronic
996091031 5:119352126-119352148 CCTGGGCCAGGGAGAGGCCATGG + Intronic
996631561 5:125639168-125639190 GGTGAGCCAAGGAGAAGGCCTGG - Intergenic
996744744 5:126837442-126837464 GCAGAGCCCAGGAGAGGTCAAGG - Intergenic
998011567 5:138699591-138699613 AGTGAGCCAAGAGGATGTCAGGG + Intronic
1000375530 5:160577426-160577448 TCTTAGCCAATGAGAGGTCAAGG - Intronic
1004556778 6:16705958-16705980 TGTGAGCCAAGCAGAGATCTTGG - Intronic
1006196223 6:32244102-32244124 TGAGTTCCAAGGAGAGGTCAGGG - Intergenic
1007374232 6:41445371-41445393 AGAGAGCCAAGGAGACGTCTTGG + Intergenic
1007832540 6:44649612-44649634 GGTCAGCCAAGAAGAGCTCAGGG + Intergenic
1010045060 6:71432277-71432299 CTTGAACCCAGGAGAGATCAAGG - Intergenic
1010795816 6:80115227-80115249 CTTGAGCCCAGGAGAGTTCAGGG - Intronic
1013428631 6:110036583-110036605 AGTGAGCTAAGGAGAGCCCATGG - Intergenic
1013473492 6:110486845-110486867 CCTGGGCCAAGGGGAGGACAGGG - Intergenic
1016658347 6:146545185-146545207 CTTGACCCTAGGAGAGGTCAAGG + Intronic
1019018905 6:168901328-168901350 AGTGGGCCAAGGAGAGGCCGCGG - Intergenic
1019277668 7:184390-184412 CGAGAGAGAAGGGGAGGTCAAGG + Intergenic
1020103333 7:5407671-5407693 AGGCGGCCAAGGAGAGGTCAAGG + Intronic
1026647630 7:72186050-72186072 GGTGAGAGAAGGAGAGGTAAGGG + Intronic
1029405312 7:100371463-100371485 TGGGTGCCAAGGAGAGGTGAGGG + Intronic
1029622749 7:101700113-101700135 CGGGAGCCACGGAGAGTTCATGG - Intergenic
1030664080 7:112254887-112254909 CTTGAGCCCAGGGGAGTTCAAGG + Intronic
1032109437 7:129062954-129062976 CGTGATTCCAGGAGAGGGCATGG + Intergenic
1032606792 7:133364210-133364232 CTTGAGCCCAGGGGGGGTCAAGG - Intronic
1033736945 7:144231952-144231974 CCTGAGGAACGGAGAGGTCAAGG - Exonic
1033746112 7:144318994-144319016 CCTGAGGAACGGAGAGGTCAAGG + Exonic
1035291985 7:157845105-157845127 CGTGGACCAACGTGAGGTCAGGG - Intronic
1035750518 8:1993019-1993041 CTTGAGCCCGGGAGAGGTCAAGG - Intronic
1038318820 8:26510528-26510550 CTTGAGCCCAGGAGAGATCAAGG - Intronic
1040902791 8:52433992-52434014 CGAGAGGCAGGGAGAGGCCATGG - Intronic
1041679734 8:60576717-60576739 AGTGAGCCAGGGAGAGGACCTGG + Intronic
1042258838 8:66835186-66835208 CCTGAGCCTTGGAGAGGTCAAGG + Intronic
1047812163 8:128422650-128422672 TGTGAGCCATGGAGATGTCTGGG + Intergenic
1048233918 8:132672436-132672458 GGTGAGAAAAGGAGAGGTCATGG - Intronic
1050302812 9:4276351-4276373 CGGGAGGGAAGGAGAGGGCACGG + Intronic
1053299989 9:36942124-36942146 CCTGAGCCAAGGAGAGGGTCAGG - Intronic
1058965750 9:110036847-110036869 AGTGAGCCAGGGAGACATCAAGG - Intronic
1059540304 9:115123667-115123689 TGTGAGACATGGAGAGGTTAGGG + Intergenic
1059680098 9:116577446-116577468 CTTGAGCCCGGGGGAGGTCAAGG + Intronic
1060476221 9:123988717-123988739 CGTGAGGGAATGAGAGGGCAAGG - Intergenic
1061221543 9:129254840-129254862 CTTGAGCCACAGGGAGGTCAAGG + Intergenic
1188866571 X:35320317-35320339 CTTGAGCCCAGGAAAGGTCAAGG - Intergenic
1189215815 X:39322272-39322294 TGAGAGCCAAGCAGAGATCATGG + Intergenic
1189375825 X:40465669-40465691 CGTGGGGCAATGAGAGGACAAGG + Intergenic
1189447065 X:41089985-41090007 CCTGAGCCCAGGAGAGGTGGAGG - Intronic
1190874067 X:54447233-54447255 CCAAGGCCAAGGAGAGGTCAAGG + Intronic
1195711050 X:107774329-107774351 GGGGAGGCAAGGAGAGGACAAGG - Intronic
1196936112 X:120732922-120732944 CGTGGGCCGAGGAGAGCTCTAGG + Intergenic
1197012888 X:121588574-121588596 TCTGAGCAAAGGAGAGGTGATGG + Intergenic
1197198492 X:123727652-123727674 CCTGAGCCCAGGAGAGCTCTGGG - Intronic
1198051349 X:132956092-132956114 CGACATCCAAGGAGAGCTCATGG - Intronic
1198844258 X:140893161-140893183 CGTGAACCAAAAAAAGGTCATGG + Intergenic
1200234510 X:154461791-154461813 AGAGAGGCAAGGAGAGGGCAGGG - Intronic
1200234717 X:154462702-154462724 AGTGAGCCAAGGAGAGGGCAGGG - Intronic
1202025499 Y:20518528-20518550 TGTGAGCCAGGCAGAGGTGAAGG - Intergenic
1202045935 Y:20737493-20737515 AGTGAGCCCAGGAGGGCTCACGG + Intergenic