ID: 1143924128

View in Genome Browser
Species Human (GRCh38)
Location 17:10354738-10354760
Sequence CTCACGAAGGGGAAGTCGAA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 57}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143924121_1143924128 -6 Left 1143924121 17:10354721-10354743 CCGTGACCTCTCCTTGGCTCACG 0: 1
1: 0
2: 4
3: 22
4: 195
Right 1143924128 17:10354738-10354760 CTCACGAAGGGGAAGTCGAAGGG 0: 1
1: 0
2: 0
3: 9
4: 57
1143924118_1143924128 27 Left 1143924118 17:10354688-10354710 CCAGCAGTTCTTCACTGTCATCG 0: 1
1: 0
2: 0
3: 11
4: 103
Right 1143924128 17:10354738-10354760 CTCACGAAGGGGAAGTCGAAGGG 0: 1
1: 0
2: 0
3: 9
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143924128 Original CRISPR CTCACGAAGGGGAAGTCGAA GGG Exonic
903337793 1:22636576-22636598 CTGAAGAAGGGGAAGTAGGAAGG + Exonic
903510130 1:23868449-23868471 CTCAAGAAGGGAAAGACGCAGGG + Intergenic
904070757 1:27795093-27795115 CCCACGACAGGGAAGTTGAAAGG - Intronic
914365572 1:146975159-146975181 CTCACTAAGGGTAAGTGGGATGG - Intronic
915561833 1:156692330-156692352 CTCAGGAAGGGGAAGTGGGGGGG + Intergenic
1065382146 10:25101445-25101467 CTCAGGAAGTGGAACTCTAAAGG - Intergenic
1069880618 10:71590437-71590459 CTCACGAACTGGCAGTCAAAGGG - Intronic
1075856962 10:125637946-125637968 ATCACCAAGGGGAAGTTGGAGGG - Intronic
1076511314 10:131015689-131015711 CTCACAAAGGGGAAGCTGGAGGG + Intergenic
1078099150 11:8319466-8319488 TTCACGAAGGGAAAGTCGAGGGG - Intergenic
1082653590 11:55824997-55825019 CTCCAGAAGGGGAATTCAAAAGG + Intergenic
1083663479 11:64262791-64262813 CTCACCTTGGGGAAGTCGAAGGG - Exonic
1085535565 11:77215256-77215278 CTCAGGGAGGGGAAGTGGAAGGG + Intergenic
1089073448 11:115718290-115718312 CTGCCCAAGGGGAAGTCGCAAGG + Intergenic
1090878292 11:130811122-130811144 CTCACGTGGTGGAAGTTGAACGG + Intergenic
1092871284 12:12808004-12808026 CTCCAGAAGGAGAGGTCGAAGGG - Intronic
1099310991 12:81022632-81022654 CTCACCAAGGGGAAGCCAAACGG - Intronic
1101122499 12:101597584-101597606 ATCTCGAAGAGGAAGTCTAATGG + Intronic
1109710575 13:66153418-66153440 CTTAGGAAGTGGAAGTGGAAAGG + Intergenic
1121121720 14:91379945-91379967 CTCACTACGGGGATATCGAAAGG + Intronic
1121510760 14:94511616-94511638 CTTCCAAAGGAGAAGTCGAATGG - Intronic
1124714188 15:32043829-32043851 CTCAAGAAAGAGAAGTCTAAAGG - Intronic
1126915683 15:53463756-53463778 CTCAGGAAGGTGAATTGGAAGGG - Intergenic
1129038589 15:72665611-72665633 CTCCCGAAGGAGAAGGCGGACGG + Exonic
1129211301 15:74071619-74071641 CTCCCGAAGGAGAAGGCGGACGG - Exonic
1129399102 15:75269468-75269490 CTCCCGAAGGAGAAGGCGGACGG + Exonic
1129402709 15:75293744-75293766 CTCCCGAAGGAGAAGGCGGACGG + Exonic
1134765694 16:16755727-16755749 CTCAGGGAGGGGAAGGGGAAGGG - Intergenic
1143924128 17:10354738-10354760 CTCACGAAGGGGAAGTCGAAGGG + Exonic
1145881034 17:28352880-28352902 CTCAAGAAGGGGAGGTGGAATGG - Intronic
1147678044 17:42220688-42220710 CTCAGGAAAGGGAGGCCGAAGGG + Intronic
1147688002 17:42298884-42298906 CTCAGGAAAGGGAGGCCGAAGGG - Intronic
1148835936 17:50465773-50465795 CTGTCGAAGGGGAAGTTGGAGGG + Exonic
1149752167 17:59155913-59155935 GACACGAAGGGGAAATGGAAAGG + Intronic
1161464791 19:4422908-4422930 CTCACGAAGGAGAAATGGGAAGG - Intronic
1161847704 19:6721081-6721103 CTGAGGGAGGGGAAGTAGAATGG + Intronic
1164055420 19:21618081-21618103 CTCTGGAAGGAGAAGACGAAGGG - Intergenic
927441741 2:23123563-23123585 CTCAGGAAGGGGGAGAAGAAAGG - Intergenic
930034070 2:47074778-47074800 CTCAGGCAGGGGAAGCCAAAAGG - Exonic
931845985 2:66204289-66204311 CTCACAAATGGGAAGTTGATAGG - Intergenic
946467382 2:219924187-219924209 CTCACCAAGGGGATGTGGAAAGG + Intergenic
1171492538 20:25531654-25531676 CTCACGAAGAGGAAGGAGCAGGG - Intronic
950783904 3:15416617-15416639 CTCATCAAGGGGAATTAGAAGGG - Intronic
965190622 3:165523556-165523578 CTCAAGAAGGAGAAGTCAGAGGG - Intergenic
967987916 3:195109058-195109080 CTCAGGAAAGTGAACTCGAAAGG + Intronic
973960624 4:56106256-56106278 CTCATGCAGGGGAAGTCTAAAGG - Intergenic
975663268 4:76708320-76708342 CCCAGGAAGGAGAAGTGGAAAGG + Intronic
976705201 4:88012761-88012783 CACAGAAAGGGGAAGTAGAATGG - Intronic
981693290 4:147532751-147532773 CTCAAGATGGTGAAGTCTAACGG - Intronic
981713635 4:147732372-147732394 CTCACGAAGCGGAACTCGAGAGG + Exonic
988430887 5:31117297-31117319 CTCATCAAGGGGAATTCAAAGGG + Intergenic
995958646 5:117812028-117812050 AACAGGAAGGGGAAGTAGAAAGG + Intergenic
1000233460 5:159336264-159336286 CACAGGAAGGGGAGGTGGAAAGG - Intergenic
1001732279 5:173969270-173969292 GTCAAGAAGGGGAAATAGAAGGG - Intergenic
1006096972 6:31662183-31662205 CCCAGGAAGGGGAAGTCAAAGGG + Exonic
1006402067 6:33823621-33823643 CTCACGCTGGGGAATTCGACTGG - Intergenic
1010340096 6:74740250-74740272 TTCAGGAGGGGGAAGTAGAAGGG + Intergenic
1024186090 7:46949471-46949493 CTCACGAGGTGGGTGTCGAAGGG - Intergenic
1037629604 8:20642069-20642091 GTCAAGAAGAGGAAGTCGACAGG - Intergenic
1038692425 8:29775330-29775352 CTCAAGATGGGAAAGTCAAAGGG + Intergenic
1048219448 8:132528002-132528024 CTCACGATGGGGAAGTTAAGTGG + Intergenic
1049002203 8:139833279-139833301 CTAAGGAAGGGGAAGTCGGCTGG - Intronic
1059314576 9:113413051-113413073 CTAACGAAGGGGAAAAGGAAAGG + Intronic
1060202684 9:121660961-121660983 CCCACGAAGGAGAAGTCCAGGGG + Intronic
1061316308 9:129798292-129798314 CTCACGAGGCAGAAGTGGAAGGG + Intergenic
1187249208 X:17581738-17581760 ACCACGAAGGGGAAGGTGAAAGG - Intronic
1195328875 X:103780306-103780328 CCCACGAATGGGAAGATGAAAGG - Intronic