ID: 1143924218

View in Genome Browser
Species Human (GRCh38)
Location 17:10355599-10355621
Sequence GGTGCCCAGTGCTCCCAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 170}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143924206_1143924218 30 Left 1143924206 17:10355546-10355568 CCTCTCCTTGGCTCAGAAGGAAG 0: 1
1: 0
2: 3
3: 25
4: 248
Right 1143924218 17:10355599-10355621 GGTGCCCAGTGCTCCCAAGCTGG 0: 1
1: 0
2: 1
3: 13
4: 170
1143924212_1143924218 2 Left 1143924212 17:10355574-10355596 CCAGAACATGGGCACCTCTCCAC 0: 1
1: 0
2: 1
3: 10
4: 149
Right 1143924218 17:10355599-10355621 GGTGCCCAGTGCTCCCAAGCTGG 0: 1
1: 0
2: 1
3: 13
4: 170
1143924209_1143924218 25 Left 1143924209 17:10355551-10355573 CCTTGGCTCAGAAGGAAGGGATG 0: 1
1: 0
2: 0
3: 35
4: 338
Right 1143924218 17:10355599-10355621 GGTGCCCAGTGCTCCCAAGCTGG 0: 1
1: 0
2: 1
3: 13
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143924218 Original CRISPR GGTGCCCAGTGCTCCCAAGC TGG Intronic
900364685 1:2306311-2306333 GGTGGCCAGTCCTGCCCAGCCGG + Intronic
903032831 1:20476102-20476124 GGTTCCCAGAGGACCCAAGCAGG + Intergenic
903130931 1:21279204-21279226 GATGCCCAGTGCTGCCAAGCAGG + Exonic
903177629 1:21590254-21590276 GGCGGGCAGTGCTCCCAGGCTGG + Intergenic
905995383 1:42376906-42376928 GGTGACAAGTGATCCCAAGAGGG - Intergenic
908564241 1:65338110-65338132 GGTGCTCACTGCTCCTGAGCTGG + Intronic
909169369 1:72275029-72275051 GGTTCCAAGAGCTCCAAAGCTGG - Intronic
913259176 1:116982933-116982955 GGTGGCCAGTCCACCCCAGCTGG - Intronic
918107343 1:181426131-181426153 TGACCCCAGTGCACCCAAGCTGG - Intronic
918940740 1:190993170-190993192 GCTGCCCTGTGCTCCCACCCAGG - Intergenic
920216661 1:204365974-204365996 GGAGGACAGTGCTCCCAGGCAGG + Intronic
1063170351 10:3504294-3504316 CCTGCCCAGTGCACCGAAGCTGG + Intergenic
1063403066 10:5766506-5766528 GGTTCCAAGAGCTCCAAAGCTGG + Exonic
1064867277 10:19895256-19895278 GGTGCCCAGCTCTACCATGCTGG - Intronic
1069948136 10:72001378-72001400 GGCCCCCAGTGGGCCCAAGCAGG + Intronic
1070393017 10:75987787-75987809 GCTGCCCAGTGCTCCCTCCCTGG - Intronic
1071355003 10:84784966-84784988 GGTGCTCTGGGGTCCCAAGCTGG + Intergenic
1072549897 10:96469504-96469526 GGGGCCCTGTGCACCCAGGCTGG + Intronic
1073473661 10:103739265-103739287 GCTGCCCAGTCCTCCCCACCAGG + Intronic
1074814414 10:117133915-117133937 GGTGCCCAGAGCTCCTGCGCTGG - Exonic
1076525261 10:131108693-131108715 GGAGCCCAATGCCCCCATGCTGG - Intronic
1077232075 11:1462262-1462284 TGTGCCCAGCCCTCCCAGGCGGG + Intronic
1077235774 11:1481372-1481394 GGGGCCCCGTGCTCTCAGGCTGG - Intronic
1078157379 11:8810563-8810585 GGGGCCCTGGGCTCCCTAGCCGG - Intronic
1079098453 11:17526295-17526317 CGTGGCCAGTGCACCCCAGCAGG - Intronic
1081637349 11:44729344-44729366 GGGGCCCCATGCTCCCAGGCAGG - Intronic
1083862353 11:65428318-65428340 GGTTCTCAGTGCTGCCAACCTGG - Intergenic
1085403268 11:76246937-76246959 GGTGGCCAGTGCTCTCCAGATGG - Intergenic
1085680145 11:78565710-78565732 AGTGCCCAGTGCTCACATGCTGG + Intronic
1088584622 11:111351596-111351618 GCAGTCCAGTTCTCCCAAGCAGG - Intergenic
1089078671 11:115759372-115759394 GGTGCTCAGAGCTCCCAAGATGG - Intergenic
1089537312 11:119168797-119168819 GGGGCCCGGTGCTCCGGAGCAGG - Exonic
1090371190 11:126254258-126254280 GGTGCTCAGCCCTGCCAAGCTGG + Intronic
1091290093 11:134434727-134434749 GGTGCCCAGGGTTCCCAGGGTGG + Intergenic
1095508558 12:42924705-42924727 GGTGGCCAGAGGTCACAAGCTGG + Intergenic
1096111763 12:49033184-49033206 GGTGCTCAGTTCCCCCCAGCTGG - Exonic
1097174330 12:57134085-57134107 GGTCCCCAGGGCCACCAAGCTGG - Intronic
1102221178 12:111195449-111195471 GGTGCCCAGTGATGCCCCGCTGG - Intronic
1103010710 12:117456268-117456290 GGTGTGCAGTGCTCCCTAGAAGG + Exonic
1103012381 12:117467059-117467081 GTTGTCCAGTGCTCCCAGGTCGG + Exonic
1104570031 12:129917263-129917285 GGTGCCCATTCCTCACCAGCTGG + Intergenic
1106592755 13:31111176-31111198 GGTGCTCTGTGCTCCCACCCAGG - Intergenic
1109650060 13:65313309-65313331 GGCACCCAGTGATGCCAAGCAGG - Intergenic
1111910207 13:94302731-94302753 TGCGCCCAGAGCTCCCAAGATGG + Intronic
1116849421 14:49893339-49893361 GGAGCCCAGTGCTCGCAGGCCGG + Exonic
1117460183 14:55937646-55937668 GGAGCCCAGTGCTCAACAGCAGG + Intergenic
1117528505 14:56636120-56636142 TGTGCCCAGTTCTTCCAAGGTGG - Intronic
1122174985 14:99910127-99910149 GATTCGCAGTGGTCCCAAGCTGG - Intronic
1124167184 15:27338616-27338638 GGTGCTCAGTGCCCCCAGGGAGG + Intronic
1125090386 15:35784079-35784101 GGTGCCCAGTGTTCGCATTCAGG - Intergenic
1127735132 15:61832380-61832402 GGTGAACAGTGCTCCCAGCCAGG + Intergenic
1127856796 15:62960150-62960172 GGAGCCCAGGCCTACCAAGCTGG - Intergenic
1128156673 15:65395858-65395880 GCTGCCCAGCGCCCCCACGCGGG - Exonic
1130252026 15:82305957-82305979 GATACCCAGTGCTCTCAGGCTGG - Intergenic
1132554869 16:568018-568040 GGGGCCAGGGGCTCCCAAGCAGG - Exonic
1133110125 16:3543068-3543090 GGTCCCCAGTGCTCCCAGCAAGG + Intronic
1136267922 16:29131824-29131846 GGCTCACAGGGCTCCCAAGCTGG + Intergenic
1137559335 16:49492848-49492870 AGTGCCCGGTGCTTCCAACCTGG - Intronic
1140295380 16:73704804-73704826 GGCTCCCAGAGCTCCCTAGCAGG - Intergenic
1141425662 16:83942948-83942970 GGTGCAGAGTGCTCGCAGGCTGG + Intronic
1141627924 16:85271216-85271238 GGGTCCCAGAGCCCCCAAGCAGG + Intergenic
1142071229 16:88092162-88092184 GGCTCACAGGGCTCCCAAGCTGG + Intronic
1142804602 17:2364819-2364841 GCTGGCCAGTGCCCCCAGGCTGG - Intronic
1142978256 17:3657690-3657712 GGCGCCCAGTTCTGCCAAGTAGG + Intronic
1143339256 17:6196292-6196314 GGTTACCAGGGCTCCAAAGCAGG - Intergenic
1143924218 17:10355599-10355621 GGTGCCCAGTGCTCCCAAGCTGG + Intronic
1144855068 17:18262968-18262990 GGTGCCCTGGGCTCCCATGAAGG - Intronic
1148718192 17:49730755-49730777 AGTGCCCAGGGCTCCCAGGAAGG + Intronic
1151593951 17:75065450-75065472 GCTGCCCAGTACTGCCAAGTGGG + Exonic
1151727031 17:75891188-75891210 TGTGCCCAGAGCTTCCAGGCCGG - Exonic
1152091699 17:78250952-78250974 GGGGCCCAGTGCCCCCCAGCTGG - Intergenic
1152861143 17:82697773-82697795 AGCGCCCAGAGCTCCCAGGCAGG - Intronic
1158448007 18:57537793-57537815 GGTGGCCTGAGCTCCCAAGCAGG - Intergenic
1158448115 18:57538780-57538802 GGTGGCCTGAGCTCCCAAGCAGG - Intergenic
1160232408 18:77058253-77058275 GATGCCGAGCGCTCCCAGGCTGG + Intronic
1161430439 19:4229326-4229348 GGTGGCCTGTGCTCCCCAGGGGG + Intergenic
1161948539 19:7454144-7454166 GGTGCCCACAACTCCCAAGATGG - Intronic
1162326573 19:10003136-10003158 TGTCCCCAGTGACCCCAAGCAGG + Intronic
1163275794 19:16283507-16283529 TGTGCCCAGGGCTCCCAGGCTGG - Intergenic
1163613129 19:18311153-18311175 GGCGCCCAGCTCTCCCAGGCAGG + Intronic
1164137678 19:22428448-22428470 GGTGGCCAGGGCTCCAAGGCGGG + Intronic
1165964993 19:39569577-39569599 GTTGCCCAGGGCTGCCAAGCAGG + Intergenic
1166020674 19:40025594-40025616 GGTGGCCAGGGGTCGCAAGCTGG - Intergenic
1167369158 19:49070657-49070679 GGTGCCCAGTGCCACAAAGTAGG + Exonic
927396883 2:22662441-22662463 GATGCCAAGGGCTCCCAGGCTGG + Intergenic
928867840 2:35939021-35939043 AGTGCTCAGTACTCCCTAGCGGG - Intergenic
929043870 2:37772224-37772246 GGTCCCCAGTGCTCCTAGGGTGG + Intergenic
930217390 2:48710658-48710680 TGTTCCCAGAGCACCCAAGCTGG - Intronic
931443466 2:62307546-62307568 GGTGCGAAGTCCTCCCAGGCTGG - Intergenic
931791704 2:65669380-65669402 GGTGCCCAGTCCTCTCCATCAGG - Intergenic
933835255 2:86240628-86240650 GAAGCCCAGTTCTCCCAGGCTGG - Intronic
935179067 2:100674220-100674242 GGCGCCCAGTGCCCTCAAGGCGG - Intergenic
936244309 2:110813386-110813408 GCTTCCCAGTGCTCCCAGCCAGG + Intronic
936798850 2:116242042-116242064 GGTTCCCAGTGATCCCTACCTGG + Intergenic
937058968 2:118967432-118967454 GGGGCTCACTGCTCCCAACCTGG - Intronic
938968421 2:136408460-136408482 GAAGGCCAGTGCTCCCATGCTGG - Intergenic
946541288 2:220687452-220687474 GGGGCCCAGCCCGCCCAAGCAGG + Intergenic
948889342 2:240899284-240899306 TGTGCCCACTGTTCCCAAACAGG - Intergenic
1171189684 20:23150378-23150400 TGTGCCCCCTGCTCCCCAGCAGG + Intergenic
1171276192 20:23858161-23858183 CCTCCCCATTGCTCCCAAGCTGG + Intergenic
1171372504 20:24670647-24670669 CGTGCCCAGGGCTCCCAGGGTGG + Intergenic
1172025149 20:31943355-31943377 GGTGCCCAGTGACTCCAAGTAGG - Exonic
1172157559 20:32839229-32839251 GGTGCCCACTGCTCCCCATCTGG - Intronic
1174580169 20:51565769-51565791 GGTGCCCAGAGCTGCTGAGCAGG + Intergenic
1175971172 20:62687497-62687519 GGTGCCAAGTGCTCCTCAGATGG - Intergenic
1176216389 20:63949955-63949977 GGTGCTCAGTCCTCTCCAGCAGG + Intronic
1178737176 21:35162756-35162778 GGAACCTAGTGTTCCCAAGCAGG + Intronic
1179618697 21:42598499-42598521 GGTGTCCAGTGGTCCTCAGCGGG - Intergenic
1181001621 22:19990404-19990426 GGTGCCTAGTACACCCAAGTGGG + Intronic
1183467451 22:37986828-37986850 GGAACCCAGTGCTCTCCAGCAGG + Intronic
1184594725 22:45506814-45506836 GGTGCCCAGTGCTCAGAGCCCGG - Intronic
1203295999 22_KI270736v1_random:43621-43643 GGTCCCCAGTGCTCCTAGGGTGG + Intergenic
950114129 3:10439389-10439411 GGTGCTCAGTCCACCCATGCTGG - Intronic
950136412 3:10584235-10584257 GGTCCCCATTCCTGCCAAGCTGG - Intronic
951333533 3:21393863-21393885 GGTACCCAGGGTTGCCAAGCCGG - Intergenic
953386017 3:42506047-42506069 TTTGCACAGGGCTCCCAAGCTGG - Intronic
955390617 3:58519864-58519886 GGTCCGCAGTTCTGCCAAGCTGG - Intronic
956105395 3:65812326-65812348 CTGGCCCAGTGCTCCCCAGCAGG + Intronic
961531861 3:127544872-127544894 GCTGCCCAGCCCTCCCCAGCAGG - Intergenic
962982148 3:140500128-140500150 GGAGCTCAGGGCTCCCAAGTGGG + Intronic
963109992 3:141680573-141680595 GGTACCCAGTCCACTCAAGCTGG + Intergenic
964365998 3:155951278-155951300 GGTGGTAAGTGCTCCCAGGCAGG - Intergenic
968466675 4:754984-755006 GGAGCTCAGTGTTCCCAGGCAGG + Intronic
968558733 4:1264975-1264997 GGGGCCCAGTCAACCCAAGCCGG + Intergenic
968815783 4:2820954-2820976 GGTGCACAGTGCTGGCCAGCTGG + Intronic
968967701 4:3777386-3777408 GGGGCCCAGTGAGACCAAGCAGG - Intergenic
980625779 4:135372660-135372682 TGCTCCCAGTGCTCCCAAGATGG - Intergenic
983777854 4:171630223-171630245 TGTTCCCAGAGCTCCCAAGATGG - Intergenic
985679443 5:1248353-1248375 GGTGCCCCCTGCTCCCACCCTGG + Intergenic
987037225 5:14030743-14030765 CTTGCCTAGGGCTCCCAAGCTGG - Intergenic
992093253 5:73338331-73338353 GATCCCCAGGGCTCCCAGGCAGG + Intergenic
994759650 5:103836665-103836687 GGGGCCCAGGGATCCCAAGGTGG + Intergenic
997977621 5:138449562-138449584 GCTGCCCAGCGATCCCAAGGAGG - Intergenic
998467653 5:142358339-142358361 GGTGGCCAGTGCTCTCAGACTGG + Intergenic
1001562129 5:172676681-172676703 GGATCTCAGTGCTTCCAAGCTGG - Intronic
1002870179 6:1160053-1160075 GGTGCCCATTGCACCCAGGTGGG + Intergenic
1005037376 6:21569434-21569456 GGTGCCCACTGCTCTGAAGGGGG - Intergenic
1005910648 6:30306645-30306667 GATGCCCTGTGCTGACAAGCTGG + Intergenic
1006059862 6:31411787-31411809 GGGGCCCAGTTCTTCCAGGCTGG - Intronic
1007317498 6:41000988-41001010 GCTCCCAAGTGCTCCCAAGGGGG + Intergenic
1011276916 6:85641605-85641627 TGTGCCCTGTGCTCCAAATCTGG - Intronic
1011418884 6:87151922-87151944 GGCGGCCTCTGCTCCCAAGCGGG + Intergenic
1014243408 6:119042003-119042025 TGTTCCCAGAGCTCCCAAGATGG - Intronic
1017758484 6:157549660-157549682 GGTTTCCAGTTCTCCCAGGCTGG - Intronic
1018170796 6:161141520-161141542 GGTGCCCTGTGGCCCCAACCTGG - Intronic
1018902066 6:168056648-168056670 GGCTGCCAGAGCTCCCAAGCCGG - Exonic
1019146581 6:169979102-169979124 GGTGCTCAGTGTTCCCACGGAGG - Intergenic
1019373277 7:674810-674832 GGTGCCCAGTTACCCCAAGCAGG - Intronic
1019720656 7:2568609-2568631 GGTGCGCTGGGCTCCCAGGCTGG + Intronic
1020250943 7:6467949-6467971 GGTGCAGAGTGCTGCTAAGCAGG + Intronic
1021531126 7:21646636-21646658 GGTGCCCAGTGAGCTCCAGCAGG + Intronic
1021886449 7:25144508-25144530 GGTTGGCAGTGCTGCCAAGCTGG - Intronic
1022332611 7:29394625-29394647 GGAGGCCAGTGCCCCCAGGCAGG - Intronic
1027188877 7:75986684-75986706 GGAGCCCGGTGCCCCCATGCAGG - Exonic
1028077411 7:86533763-86533785 GCTGCCCTGTGGACCCAAGCTGG + Intergenic
1029618905 7:101677745-101677767 GGGGCCCACTGCAGCCAAGCTGG - Intergenic
1029706319 7:102278158-102278180 GGGGCCCAGTGCTGCCCAGCAGG - Intronic
1031017628 7:116593031-116593053 GGCCCCCAGTGTTCCTAAGCTGG - Intergenic
1031742763 7:125455578-125455600 TGTTCCCAGAGCTCCCAAGATGG + Intergenic
1031971500 7:128068083-128068105 GATGCCTAGTGCTTCCAAGTAGG - Intronic
1037857816 8:22384162-22384184 GGGGCCCAGTGCTGCCAAGAGGG - Intronic
1038331469 8:26612828-26612850 GGTGCCAAGTGCTCCCAGTTTGG + Intronic
1040356444 8:46623065-46623087 GGGGACCAGTGCTTCCTAGCAGG + Intergenic
1048631547 8:136247991-136248013 TGTTCCCAGAGCTCCCAAGATGG - Intergenic
1049416554 8:142498068-142498090 GGGTCCCAGAGTTCCCAAGCAGG - Intronic
1050060899 9:1708683-1708705 GCTGCCCTCTGCTCCCAAGATGG - Intergenic
1051041516 9:12817956-12817978 CGTGCCCAGCGCTCCCACGGTGG + Intronic
1051970114 9:22877731-22877753 TGTTCCCAGAGCTCCCAAGATGG + Intergenic
1052772443 9:32702295-32702317 AGTGGCAAGTGATCCCAAGCAGG - Intergenic
1057209794 9:93193504-93193526 GGTGCCCACAGCTCCCGGGCGGG - Intronic
1058715607 9:107719644-107719666 GGTGCCAAGGGCTCCCTGGCTGG + Intergenic
1060826205 9:126689432-126689454 TGTGCACAGCGCTCCCAAGGTGG + Intronic
1060932060 9:127495441-127495463 GGTCCCCAGGGCTCCCTGGCCGG - Intronic
1061923363 9:133794337-133794359 GCTGCCCAGTGCAGCCGAGCGGG + Intronic
1062029148 9:134354224-134354246 CGTGCCGAGTGCTCCCATCCTGG + Intronic
1062134321 9:134916688-134916710 TGTGCCCTGGGCTGCCAAGCGGG + Intronic
1062286434 9:135775014-135775036 AGTGCCCAGGGCACCCATGCAGG - Intronic
1062376568 9:136264407-136264429 GCTGCCCAGGGATCCCAGGCGGG - Intergenic
1062516456 9:136939420-136939442 GGTCCCCAGGGCTTCCCAGCTGG + Intronic
1188190308 X:27164550-27164572 TGTGCCAAGTGTTCCCAACCAGG - Intergenic
1190056938 X:47186496-47186518 GCTGCCCCGTGCACCCAGGCCGG - Exonic
1190912621 X:54786879-54786901 GGTGCCCAGTGAGCCCCAGCGGG + Intronic
1190918342 X:54826525-54826547 GGTGCTCAGTGAGCCCCAGCGGG - Intergenic
1195760380 X:108239514-108239536 CGTGGCCAGAGCTCCCAGGCTGG - Intronic
1195885600 X:109634366-109634388 GGTGGCCAGAGCTCCCTGGCAGG - Intronic