ID: 1143924461

View in Genome Browser
Species Human (GRCh38)
Location 17:10357566-10357588
Sequence ATTGTGATACACTTTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 185}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143924461_1143924468 12 Left 1143924461 17:10357566-10357588 CCTTCCTCAAAGTGTATCACAAT 0: 1
1: 0
2: 0
3: 17
4: 185
Right 1143924468 17:10357601-10357623 TAGATTGATCTCAATCACTTGGG 0: 1
1: 0
2: 0
3: 12
4: 231
1143924461_1143924471 24 Left 1143924461 17:10357566-10357588 CCTTCCTCAAAGTGTATCACAAT 0: 1
1: 0
2: 0
3: 17
4: 185
Right 1143924471 17:10357613-10357635 AATCACTTGGGGGTAGAAAAAGG 0: 1
1: 0
2: 1
3: 24
4: 265
1143924461_1143924467 11 Left 1143924461 17:10357566-10357588 CCTTCCTCAAAGTGTATCACAAT 0: 1
1: 0
2: 0
3: 17
4: 185
Right 1143924467 17:10357600-10357622 GTAGATTGATCTCAATCACTTGG 0: 1
1: 0
2: 0
3: 6
4: 111
1143924461_1143924470 14 Left 1143924461 17:10357566-10357588 CCTTCCTCAAAGTGTATCACAAT 0: 1
1: 0
2: 0
3: 17
4: 185
Right 1143924470 17:10357603-10357625 GATTGATCTCAATCACTTGGGGG 0: 1
1: 0
2: 0
3: 10
4: 75
1143924461_1143924469 13 Left 1143924461 17:10357566-10357588 CCTTCCTCAAAGTGTATCACAAT 0: 1
1: 0
2: 0
3: 17
4: 185
Right 1143924469 17:10357602-10357624 AGATTGATCTCAATCACTTGGGG 0: 1
1: 0
2: 0
3: 10
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143924461 Original CRISPR ATTGTGATACACTTTGAGGA AGG (reversed) Intronic
901550180 1:9990113-9990135 ATTCTGATACATTTTGAAGCAGG - Intergenic
902475680 1:16685173-16685195 ATTTTGATACAATTTGAGGGAGG - Intergenic
906214134 1:44029528-44029550 ATTGGGATAGGTTTTGAGGATGG - Intronic
906233147 1:44183056-44183078 ATTGTGATAGTCTTTGTGTAAGG + Intergenic
907740591 1:57161975-57161997 ATTGTGATACATCTGTAGGATGG - Intronic
908846766 1:68332621-68332643 ATTGAGATACATTTTCAGGAAGG - Intergenic
909575751 1:77174169-77174191 ATTGTAATACAGTTTATGGAGGG - Intronic
909887908 1:80965543-80965565 ATGGAGATAGACTTTGAGGGGGG - Intergenic
914921519 1:151850767-151850789 AATGTGGTACACTTGGAAGAGGG - Intronic
916977816 1:170100347-170100369 ATTGTGATAGACTTAAAGGATGG + Intergenic
917830209 1:178875246-178875268 ATTGTGAAAAACTTTGAGATGGG - Intronic
918133465 1:181648733-181648755 ATTGAGCTACAGTTTGAGGGTGG - Intronic
919878393 1:201886998-201887020 AGGGGTATACACTTTGAGGAGGG + Intergenic
919878398 1:201887031-201887053 AGGGGTATACACTTTGAGGAAGG + Intergenic
921890332 1:220347242-220347264 AATTTGATACACCCTGAGGAAGG - Intergenic
921927970 1:220728496-220728518 ATTTTGATACTCCTTGAGGAAGG - Intergenic
922601894 1:226862555-226862577 ATTTTGAGACACTCTTAGGATGG - Intergenic
923693958 1:236227911-236227933 ATTGTCATATACTTTTAGGGAGG - Intronic
1063851580 10:10198443-10198465 TTTGTGTGACACTTTCAGGAAGG - Intergenic
1065763155 10:29002019-29002041 ATGTTGCTACACTTTGAGGATGG + Intergenic
1066554074 10:36592028-36592050 ATTGTGGTCCACCTTGTGGAAGG + Intergenic
1068397616 10:56484690-56484712 ATTGTAGTACACTATGAGGTTGG - Intergenic
1071529854 10:86380836-86380858 ATTGTTTTACACTTTGGGGTTGG - Intergenic
1071585948 10:86821661-86821683 ATTGTTATTCACTTTTAGCAAGG - Intronic
1072115540 10:92367155-92367177 ATTGTGATATACATTGAACATGG + Intergenic
1072423394 10:95308749-95308771 ATTGTAACACACTTTGAAAATGG - Intergenic
1072544554 10:96425624-96425646 AGTTTGATACACTTTTATGATGG - Intronic
1079985553 11:27196968-27196990 ATGGTGATATTCTTTGAGGAGGG + Intergenic
1081214420 11:40377515-40377537 ATTTTGTTACATTTTGGGGAAGG + Intronic
1081352781 11:42074782-42074804 ATTGTGATACACATTCACCATGG - Intergenic
1082557569 11:54581118-54581140 ATTGTGATACACTCTAACTAAGG - Intergenic
1082663451 11:55944878-55944900 ATTGTCAAAAACTTAGAGGATGG + Intergenic
1084994866 11:72966835-72966857 AATATGATATAGTTTGAGGAAGG + Intronic
1085199749 11:74694729-74694751 ATTGTGAGTCATCTTGAGGAGGG + Intergenic
1087340960 11:96906544-96906566 ATTGTTATTCTCTTTGGGGAAGG + Intergenic
1089004126 11:115076650-115076672 AGGGTGAGACAGTTTGAGGAAGG - Intergenic
1089432373 11:118435402-118435424 ATTATGATACACTGGGTGGAAGG - Intergenic
1090639360 11:128717199-128717221 GTTGTGATGCACTTGGAGCAGGG - Intronic
1090894160 11:130954625-130954647 ATTCTGATACAGAATGAGGATGG - Intergenic
1091235238 11:134017784-134017806 ATTGTGATGAGCTTTGAAGAGGG - Intergenic
1091236426 11:134025231-134025253 AGTGTGATACCCGCTGAGGAGGG - Intergenic
1091926227 12:4352590-4352612 TTTATCATAAACTTTGAGGAAGG + Exonic
1093189728 12:16060224-16060246 ATTTTGAGATATTTTGAGGATGG - Intergenic
1093305361 12:17510734-17510756 AATGTGATACACGTTATGGAAGG + Intergenic
1097646794 12:62245087-62245109 ATTTTTATACACTCTGAGTAGGG - Intronic
1098024491 12:66188146-66188168 TGTGTGAAGCACTTTGAGGAAGG + Intergenic
1098910091 12:76200101-76200123 ATTGTCATAAATTTTCAGGATGG + Intergenic
1100041070 12:90317804-90317826 ATTGTGATACTCTTTGACCTGGG + Intergenic
1100580155 12:95931248-95931270 AAAGTGATGCACTTTGAAGATGG - Intronic
1101815692 12:108144345-108144367 TTTGTAATAGGCTTTGAGGATGG + Intronic
1102816876 12:115873133-115873155 ATTGTGATGGACTTAGAGGATGG + Intergenic
1103349866 12:120276685-120276707 ATTGGGCTACACTTTGCAGATGG - Intergenic
1105640374 13:22256564-22256586 TTTCTGATATACTTTGGGGAAGG + Intergenic
1108061770 13:46540259-46540281 ATTGTGAAAGACTTTGAAGAGGG + Intergenic
1109451850 13:62525319-62525341 AGTCTGATTCACTTTGAGGAGGG + Intergenic
1109967470 13:69720024-69720046 ATTGTTCTAAACTGTGAGGATGG - Intronic
1112577139 13:100645712-100645734 ATTGTGATAGACTGTGATCAGGG - Intronic
1114830982 14:26141188-26141210 ATGGTGCTACACTTTGGGAATGG - Intergenic
1116764604 14:49054616-49054638 GTTGTTATACACTTTTATGAGGG - Intergenic
1119899566 14:78248403-78248425 ATTGAAATTCACTTTCAGGAAGG - Intronic
1120997976 14:90431097-90431119 AATGTGAAACAGTGTGAGGAAGG - Intergenic
1126086315 15:45013894-45013916 ATGGTAATGGACTTTGAGGACGG - Intergenic
1126178946 15:45766072-45766094 GTTGTGATACAAACTGAGGACGG - Intergenic
1127495655 15:59509593-59509615 GCAGTGATGCACTTTGAGGACGG + Intronic
1130923844 15:88370611-88370633 ACTGTACTACACTTTGATGAGGG + Intergenic
1131943224 15:97590342-97590364 AATGTGAAAGACTTTGAGCAAGG - Intergenic
1137915760 16:52428311-52428333 ATTGTGATCCACTGCAAGGATGG + Intergenic
1143034126 17:3984741-3984763 ATGATGATTCACTTTGAGAATGG - Intergenic
1143924461 17:10357566-10357588 ATTGTGATACACTTTGAGGAAGG - Intronic
1153669208 18:7394078-7394100 ACTGTGATACATTTTCATGATGG - Intergenic
1156658983 18:39323376-39323398 ATTGTCACCCACATTGAGGATGG - Intergenic
1157016113 18:43716039-43716061 ATTATGAAACATTTTGTGGAAGG + Intergenic
1158753150 18:60289788-60289810 ACTCTGATCCTCTTTGAGGAGGG - Intergenic
1162624679 19:11875211-11875233 ATTTTGATAATCTTTGAAGAAGG + Intronic
1168003255 19:53465964-53465986 AGAGTGATACACTTCAAGGAAGG - Intergenic
925677887 2:6385534-6385556 ATTGTGCTACAGTGTCAGGAGGG + Intergenic
928290687 2:30034591-30034613 ATTGGGATGCACTTTGAGAACGG - Intergenic
928619150 2:33071294-33071316 ATTCTCATTCACTGTGAGGAAGG - Intronic
929045659 2:37786474-37786496 ACTGTGATATATTATGAGGATGG - Intergenic
930039691 2:47111359-47111381 ATTTTGAAACACATTCAGGAGGG + Intronic
930561994 2:52971126-52971148 ATTGTGTTAGACTCTAAGGATGG + Intergenic
933048570 2:77572197-77572219 ATTGTCAGACACATTCAGGAGGG + Intronic
934082692 2:88483044-88483066 GGTGTGGTACACTTTGAAGATGG - Intergenic
935803644 2:106725793-106725815 ATTTTAAAATACTTTGAGGAGGG - Intergenic
937510107 2:122586083-122586105 ATTTTGTTACACTGTGAGGAGGG + Intergenic
940014452 2:149088642-149088664 TTTGTGATAAACTTTTAGGAGGG - Intronic
940070776 2:149685052-149685074 ATTGATGTCCACTTTGAGGAAGG + Intergenic
940462205 2:153979228-153979250 ATAGTGTTGTACTTTGAGGATGG + Intronic
945025640 2:205617144-205617166 ATTGTGATCTACTTAGAGGTTGG - Intronic
946432081 2:219631377-219631399 TTTGTGCTGGACTTTGAGGATGG + Intronic
947076678 2:226352455-226352477 CTTGTGATAAACCTTGAGTATGG - Intergenic
947515000 2:230795512-230795534 ATTCGGATTCACTTTGAGGGGGG + Intronic
1169382696 20:5121919-5121941 ATTGTGTAACAGTTTGAGGCTGG - Intronic
1170076703 20:12427559-12427581 ATTGTTATACTCTTTAAAGAAGG - Intergenic
1172675300 20:36665933-36665955 AATGACTTACACTTTGAGGAGGG + Intronic
1177957848 21:27623095-27623117 AGTGTGAGGCTCTTTGAGGAAGG - Intergenic
1179535943 21:42052162-42052184 ATTAAGATACACTTTCAGGCTGG + Intergenic
1179614609 21:42573794-42573816 ATTCTGATACACATGTAGGATGG - Intronic
1183311869 22:37114383-37114405 ATTGTGATCGACTGTGTGGAGGG - Intergenic
949098519 3:114849-114871 ATTGGGATACATTTCGAGGGTGG + Intergenic
949176132 3:1064742-1064764 ATTTTCATTCACTTTCAGGAGGG - Intergenic
949221930 3:1645623-1645645 ATTGTGAACTACTTTGAGGGCGG - Intergenic
951113658 3:18834803-18834825 ATTCAGATACATTTTGGGGAAGG - Intergenic
952078750 3:29731382-29731404 ATGGTGATTCAGTTAGAGGAAGG - Intronic
953038687 3:39235713-39235735 ATTAAAATACACTTTGATGATGG + Intergenic
953572039 3:44078883-44078905 TTTGTGAAACACTCAGAGGAGGG - Intergenic
956041061 3:65145543-65145565 ATTTTGATACAATTTCTGGAGGG + Intergenic
956210938 3:66800696-66800718 ACTGTGAAACACTTTCAGGCAGG + Intergenic
957778717 3:84790287-84790309 ATTCTGAAACACATTGATGATGG + Intergenic
957906833 3:86568485-86568507 ACTGTGATACATCTAGAGGATGG + Intergenic
958728932 3:97939453-97939475 AATGTGATCCTCTTTGAGGCTGG + Intronic
959145240 3:102536135-102536157 ATTACTATACACTTTGAGGCTGG + Intergenic
959294581 3:104519758-104519780 ATCTTGATACTCTTTGAGGAAGG - Intergenic
959720297 3:109479443-109479465 ATTGTGAGTCACTTTGAGGTAGG + Intergenic
962433454 3:135342443-135342465 ATTTTGATACTTTTTGAGGAAGG - Intergenic
962564533 3:136644218-136644240 GTGGTGAAAAACTTTGAGGATGG + Intronic
962815728 3:138996568-138996590 ATTGTGATACGCTTATAGAATGG - Intergenic
963743563 3:149103272-149103294 ATAATGATATATTTTGAGGATGG + Intergenic
967347808 3:188477963-188477985 ATTTTGATGCAGATTGAGGATGG + Intronic
971360097 4:25930132-25930154 ATGATGAGACATTTTGAGGATGG + Intergenic
971610580 4:28720352-28720374 ATTGTGTTATACTTTGCTGAAGG - Intergenic
971843811 4:31892739-31892761 ATTCTGATACCCCTTGAGGGGGG + Intergenic
974574231 4:63697368-63697390 ATTGTGAACCACTTTGATGAAGG + Intergenic
976192498 4:82501486-82501508 AATGGGATACGCTTTGGGGATGG + Intronic
976961487 4:90981405-90981427 ATTTTGATTCACTTTCAGAATGG - Intronic
977798499 4:101197217-101197239 TTTGAGAGACACTTTTAGGAAGG - Intronic
978508078 4:109482522-109482544 ATAGTGAGATAGTTTGAGGATGG + Intronic
979542828 4:121905789-121905811 ATTTTGCTACACCCTGAGGATGG + Intronic
981602961 4:146511754-146511776 ATTCTGATTCACTGTAAGGATGG - Intronic
983327487 4:166275392-166275414 ATTGTGCTACAATTTGAATATGG + Intergenic
984879047 4:184394408-184394430 ATTCTGCTACACTTTCTGGAAGG + Intronic
987731214 5:21775081-21775103 GCTGTGATTCACATTGAGGAAGG + Intronic
989703578 5:44300385-44300407 ATTGTGATACAGGTTGAAGTAGG + Intergenic
990735330 5:58854429-58854451 ATGCTGATTCACTCTGAGGATGG - Exonic
992167969 5:74073723-74073745 AATGAGTTCCACTTTGAGGATGG - Intergenic
992193827 5:74320248-74320270 ATTTTCATAGACTATGAGGAAGG - Intergenic
994206190 5:97038541-97038563 ATTCTGATAGACTTTTTGGATGG + Intergenic
994619609 5:102147445-102147467 ATTGTGATAAACATTGAAGGAGG - Intergenic
994709011 5:103243203-103243225 CTTGTGAAACACATTTAGGAGGG + Intergenic
995033166 5:107502650-107502672 AGTTTGATACACTTCGAGCACGG - Intronic
995420356 5:111959293-111959315 ATAGTGGTTAACTTTGAGGAAGG + Intronic
995759777 5:115551019-115551041 ATTAGGATACACTTTGAGTGAGG - Intergenic
996857111 5:128020565-128020587 AGTGTGTTACAGTTTGAGGCAGG - Intergenic
998619993 5:143783110-143783132 AAGGTGATGCAATTTGAGGAGGG + Intergenic
998631689 5:143905592-143905614 AGTGTGATATAGTTTGAGGTTGG + Intergenic
998769770 5:145529125-145529147 ATTGTGAAACAGTTTCAGAATGG + Intronic
999733561 5:154494598-154494620 ATTGTGGAAGACTTTGTGGAGGG + Intergenic
1004023361 6:11795108-11795130 ATTTTCACACAGTTTGAGGATGG - Intronic
1005242851 6:23852683-23852705 ATTGTGCTAAATTTTAAGGATGG - Intergenic
1005363513 6:25054945-25054967 ATTCTTATACATTTTTAGGATGG + Intergenic
1006102630 6:31695197-31695219 ACTGTGATTATCTTTGAGGATGG - Intronic
1007009444 6:38401044-38401066 ATTGTGATACATATTATGGAAGG - Intronic
1007159462 6:39777293-39777315 ATTGTGAAAGACCCTGAGGAGGG - Intergenic
1008077579 6:47161368-47161390 GTTGGCATACAGTTTGAGGAAGG + Intergenic
1013163012 6:107564328-107564350 ATAGTGATAGACTTTATGGAAGG - Intronic
1013789303 6:113817764-113817786 ATTGTGGTACACTTTCACAATGG + Intergenic
1016980631 6:149850850-149850872 ATTGTGGAAGACTTTGAGGTGGG - Intronic
1021578596 7:22128607-22128629 ATTGTGTTACACTTGGATGCTGG - Intronic
1026375487 7:69746411-69746433 ATGGTGATACATTCTGTGGAGGG + Intronic
1027365586 7:77454487-77454509 ATTGGAATAAACTTTCAGGAAGG + Intergenic
1027540908 7:79464060-79464082 ATAGTGAAACATTTTGGGGAGGG - Intergenic
1027770963 7:82405736-82405758 GATGTGACACACTTTGATGATGG - Intronic
1028545094 7:91989472-91989494 TTTTTGATACCCTTTGAGCAGGG + Intronic
1029619146 7:101679149-101679171 ATTGGGATCCACTGTGGGGAAGG - Intergenic
1031024183 7:116662559-116662581 ATTGTAATACACTGTGAGATAGG + Intergenic
1034529926 7:151689387-151689409 CTTGGGATACACTTCCAGGAGGG - Intronic
1036417659 8:8565455-8565477 CTTCTGATGCACTTTTAGGATGG - Intergenic
1038459561 8:27704438-27704460 ATTATTATACATTTTGAGGTGGG - Intergenic
1038881129 8:31613369-31613391 ATTATCACACATTTTGAGGAAGG + Intergenic
1039046418 8:33454464-33454486 AATGTGACCCACTTTGAGGTGGG - Intronic
1039370448 8:36979044-36979066 ATTGGGATGCACGTTGAGGCAGG - Intergenic
1039938009 8:42064472-42064494 ATTGTCATAAACTTTGAAAAAGG + Intergenic
1041595200 8:59642637-59642659 ATTCTTATACACTTTGTGTATGG - Intergenic
1042124395 8:65523037-65523059 ATTGTGATGGACTTTGTGCAAGG - Intergenic
1044025057 8:87158974-87158996 GTTTTTATACAATTTGAGGAAGG + Intronic
1044044707 8:87417018-87417040 ATTGTAATACACTATGTTGATGG + Intronic
1044089202 8:87978326-87978348 AATGTGAAACAGTTTGAAGAGGG - Intergenic
1045396864 8:101769515-101769537 AATGTGAGCCACTTCGAGGATGG - Intronic
1045870782 8:106924556-106924578 AGTGTGATACACAGTGTGGAAGG - Intergenic
1048151992 8:131903429-131903451 ACTTTGACCCACTTTGAGGAAGG + Intergenic
1048217182 8:132506988-132507010 ATTATGATCCATCTTGAGGATGG + Intergenic
1048949600 8:139484693-139484715 ATTGCATTTCACTTTGAGGAAGG - Intergenic
1050294534 9:4192064-4192086 CTTGTGATAAACATTGAGCATGG + Intronic
1050481275 9:6089578-6089600 CTTATCATACACTTTGAGTAGGG + Intergenic
1051790117 9:20792454-20792476 ATGGGGATACGTTTTGAGGAAGG - Intronic
1055012968 9:71587140-71587162 CTTTTGATACACTTGGAGAAAGG - Intergenic
1057612406 9:96557157-96557179 ACTGTGATGCACTGTGAGCAGGG + Intronic
1058734723 9:107883778-107883800 AATGTGACACACTTTGTGCAGGG + Intergenic
1058918180 9:109587432-109587454 ATTGTGAAAGACTTTGAAGTGGG + Intergenic
1059139317 9:111837087-111837109 ATTTTGTTAAACTATGAGGATGG + Intergenic
1061056705 9:128226582-128226604 AGTGTGATTCAGTTTTAGGAAGG + Intronic
1187534535 X:20127863-20127885 ATTTTGATACAATTTGAGGGAGG - Exonic
1188741012 X:33781494-33781516 ATTATGATGCACTTTGGGCATGG + Intergenic
1188907668 X:35807830-35807852 ATTGTGATTATCTCTGAGGATGG - Intergenic
1190836316 X:54104241-54104263 AGGTTGATACAGTTTGAGGAGGG - Intronic
1192321086 X:70091410-70091432 AGTGTGCTAGACTTAGAGGAAGG - Intergenic
1194238783 X:91418219-91418241 ATTGTCAAACAGTTTCAGGAAGG + Intergenic
1194785656 X:98081304-98081326 ATTTTGATCCACTTTCAGAATGG + Intergenic
1194853594 X:98900247-98900269 ATTGTTAGACATTTTGAGGTTGG + Intergenic
1198093094 X:133351265-133351287 ATTATGATTGACTTTGAGGCAGG - Intronic
1198702014 X:139407057-139407079 ACTGTAATACTCTTTGAGAAAGG - Intergenic
1199559755 X:149150407-149150429 AATGTGGTACAATTTGAGTATGG + Intergenic
1200839285 Y:7763914-7763936 CTTGTAATACAGTTTGAGGCCGG - Intergenic