ID: 1143925004

View in Genome Browser
Species Human (GRCh38)
Location 17:10361833-10361855
Sequence ACCTGGATTGGGGGTTCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 166}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143924996_1143925004 15 Left 1143924996 17:10361795-10361817 CCCTGAGTGGCTACTGATATGGT 0: 1
1: 0
2: 0
3: 10
4: 102
Right 1143925004 17:10361833-10361855 ACCTGGATTGGGGGTTCCCTGGG 0: 1
1: 0
2: 2
3: 15
4: 166
1143924993_1143925004 28 Left 1143924993 17:10361782-10361804 CCAACGTAGCATTCCCTGAGTGG 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1143925004 17:10361833-10361855 ACCTGGATTGGGGGTTCCCTGGG 0: 1
1: 0
2: 2
3: 15
4: 166
1143924997_1143925004 14 Left 1143924997 17:10361796-10361818 CCTGAGTGGCTACTGATATGGTT 0: 1
1: 0
2: 0
3: 9
4: 104
Right 1143925004 17:10361833-10361855 ACCTGGATTGGGGGTTCCCTGGG 0: 1
1: 0
2: 2
3: 15
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143925004 Original CRISPR ACCTGGATTGGGGGTTCCCT GGG Intronic