ID: 1143927284

View in Genome Browser
Species Human (GRCh38)
Location 17:10383105-10383127
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143927276_1143927284 6 Left 1143927276 17:10383076-10383098 CCAGAGAGGAGGGGAGTCACTTC No data
Right 1143927284 17:10383105-10383127 GTCCCAGGGCATCATGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143927284 Original CRISPR GTCCCAGGGCATCATGGGAA GGG Intergenic
No off target data available for this crispr