ID: 1143930131

View in Genome Browser
Species Human (GRCh38)
Location 17:10413960-10413982
Sequence CAGGGGCTGTGATGCATTAT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 2, 1: 1, 2: 3, 3: 14, 4: 121}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143930131_1143930133 -8 Left 1143930131 17:10413960-10413982 CCCATAATGCATCACAGCCCCTG 0: 2
1: 1
2: 3
3: 14
4: 121
Right 1143930133 17:10413975-10413997 AGCCCCTGTGAGTTTATAGATGG 0: 1
1: 1
2: 0
3: 9
4: 105
1143930131_1143930137 8 Left 1143930131 17:10413960-10413982 CCCATAATGCATCACAGCCCCTG 0: 2
1: 1
2: 3
3: 14
4: 121
Right 1143930137 17:10413991-10414013 TAGATGGACACTTTCTCTTCAGG 0: 1
1: 0
2: 1
3: 8
4: 125
1143930131_1143930138 21 Left 1143930131 17:10413960-10413982 CCCATAATGCATCACAGCCCCTG 0: 2
1: 1
2: 3
3: 14
4: 121
Right 1143930138 17:10414004-10414026 TCTCTTCAGGAGTGAAGCCCAGG 0: 1
1: 0
2: 1
3: 23
4: 294

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143930131 Original CRISPR CAGGGGCTGTGATGCATTAT GGG (reversed) Exonic
900346034 1:2210609-2210631 CGGGGGCTGTGAAGCTTTCTGGG + Intronic
900824307 1:4913825-4913847 CAGAGGCTGTGATCCATTCCGGG + Intergenic
901643806 1:10706140-10706162 CATGGGCTGTGATGACTCATGGG - Intronic
901791830 1:11657865-11657887 TAGGGGCTGAGAAGCATTTTTGG - Intronic
904327684 1:29738223-29738245 CAAGGGCTGAGATGCATGCTGGG - Intergenic
908599534 1:65724187-65724209 CAGGGGCTGAGAAGCCTTCTGGG + Intergenic
910451313 1:87348827-87348849 CAGGGCCTGTAGTACATTATTGG - Exonic
916019439 1:160779097-160779119 CTGGGGTTCTGATGCAGTATGGG + Intergenic
918664380 1:187131294-187131316 CAGGGGGTGGGATGCCATATGGG - Intergenic
918839234 1:189513225-189513247 CAGCGGCTGTGCTGCACTGTGGG - Intergenic
920315367 1:205072818-205072840 CAGGGGCAGTGATGGACTATGGG + Intronic
921469497 1:215531650-215531672 CAGGGTCTGAGATGCATTTCAGG - Intergenic
1063145242 10:3290041-3290063 CGGGGGCGGTGATGCCTTACGGG - Intergenic
1064072301 10:12241032-12241054 CAGGTACTGTGATGCATTCCTGG - Intronic
1065196474 10:23270790-23270812 CAGCAGCTGTGCTGCATTGTGGG - Intronic
1067669017 10:48302992-48303014 CAGGGTCTGTCTTGCTTTATCGG + Intergenic
1072361559 10:94664265-94664287 CAGCAGCTGTGCTGCATTGTGGG + Intergenic
1075365077 10:121879669-121879691 CAGGGGCTGTGAAGAAACATGGG - Intronic
1075418312 10:122282012-122282034 CAAGGGCTGTGGTTCATTTTAGG - Intronic
1078762167 11:14260094-14260116 CAGGGGAGGTCATGCTTTATGGG - Intronic
1080954863 11:37081673-37081695 AATGGGCTGTGATACATTAGTGG + Intergenic
1082044743 11:47715501-47715523 CTGGGGCTGTGATGTATGAGGGG - Intergenic
1084445197 11:69199571-69199593 CAGGGGCTGTGAAGCAAGAGAGG - Intergenic
1085534165 11:77208148-77208170 CAGGGGCTGGGCCGCATTCTTGG + Intronic
1085935918 11:81142687-81142709 GAGGAGCTGTGATGCATATTTGG + Intergenic
1091481996 12:842710-842732 AAGGGGCTTATATGCATTATTGG + Intronic
1096814841 12:54195653-54195675 CAGGGGCTGTGGGGAATGATGGG - Intergenic
1100264083 12:92959136-92959158 CAGGGGCTGTGGGGCCTTAGAGG + Intergenic
1100464289 12:94831726-94831748 CAGGGGCTGTGAGGTTTTCTTGG - Intergenic
1100822758 12:98447134-98447156 TAGGGAGCGTGATGCATTATAGG - Intergenic
1101564898 12:105895865-105895887 CAGGGGCTGTGATCCAGTAGGGG - Intergenic
1102207315 12:111099338-111099360 CAGAGGCAGTGCTGCATTTTGGG + Intronic
1102721868 12:115023468-115023490 CAAAGGCTGTGATGAATTCTAGG - Intergenic
1104670997 12:130680128-130680150 CAGGAGCTCTCATGCATTATTGG + Intronic
1109307120 13:60653156-60653178 CAGGGGCAGAAATGCTTTATGGG + Intergenic
1109606402 13:64703687-64703709 CATGTAATGTGATGCATTATAGG + Intergenic
1113516453 13:110906055-110906077 CAAGGGCACTGATGCATTCTAGG + Exonic
1118645523 14:67834906-67834928 CAGGGACTGTGCTAGATTATGGG - Intronic
1119525298 14:75317922-75317944 CAGGGGCCTTTATGCAGTATTGG + Intergenic
1121393069 14:93593063-93593085 CAGGGACTGTTATGCACTCTGGG - Intronic
1121872963 14:97426287-97426309 CAGGGGCTGTGATGGCATGTTGG - Intergenic
1122497355 14:102167848-102167870 CAGTGCCTTTGATGCATTATAGG + Intronic
1202940585 14_KI270725v1_random:142079-142101 AAGGGGCTGTGATAAATTAAAGG + Intergenic
1123969908 15:25498173-25498195 CAGGGACTCTCATTCATTATTGG + Intergenic
1124644819 15:31430948-31430970 CAGGGGCTATGATGAATTGGAGG - Intronic
1127424916 15:58846039-58846061 CAGAGGCTGGGATGCATATTTGG + Intronic
1130745874 15:86653370-86653392 CAGGGGCTTTGTGGTATTATAGG - Intronic
1131223210 15:90602346-90602368 CAGAGGCTGTGAGGAATAATTGG - Exonic
1131796234 15:96019555-96019577 CAGATGCTGTGATGCAGTAGAGG + Intergenic
1134027923 16:10968495-10968517 CAGAGTTTGTCATGCATTATGGG - Intronic
1137553451 16:49455762-49455784 CAGTGGCTGTGATGCAAGCTGGG - Intergenic
1137966704 16:52941872-52941894 GAGGGGCTGTGGTGCAGTCTGGG - Intergenic
1138463314 16:57167092-57167114 CAGGAGCTGTGAAGCATAAGAGG - Exonic
1143923642 17:10350614-10350636 CGGGAGCCGTGATGCATTATGGG - Exonic
1143930131 17:10413960-10413982 CAGGGGCTGTGATGCATTATGGG - Exonic
1143933803 17:10460974-10460996 CTGGAGCCGTGATGCATTATGGG - Exonic
1143938469 17:10512466-10512488 CAGGGGCTGTGATGCATTATGGG - Exonic
1143940860 17:10539986-10540008 CGGGGGCTGTGATGCATTATGGG - Exonic
1148861681 17:50607827-50607849 CAGGGGTTGTGGTTCATGATGGG - Exonic
1157114992 18:44854153-44854175 CAGGCCTTGTGATGCATTCTGGG - Intronic
1158654662 18:59320126-59320148 GAGGGGGTGTCATGCATTATGGG + Intergenic
1167267242 19:48489629-48489651 CAGGCGCTGTGCTGCATACTCGG + Intronic
925262337 2:2539620-2539642 CAGGGGCTGTGAGGCATAAGCGG + Intergenic
925327670 2:3035921-3035943 CAGGGCCTGTGATGCTTTTCAGG - Intergenic
926354957 2:12033319-12033341 AATGGGGTGTGATGCCTTATAGG + Intergenic
934578102 2:95415798-95415820 GAGGGGCTGGGATGCAGCATGGG - Exonic
935915878 2:107948657-107948679 CATAGGCTGTGATGAATTGTTGG - Intergenic
937273812 2:120671706-120671728 CATGGGCTGTGAGGCATTGCAGG - Intergenic
939456465 2:142443464-142443486 CAGGAGCTGTGATTCAGTATTGG + Intergenic
939476125 2:142689071-142689093 CAGGTGCTGTGATGCCATCTAGG - Intergenic
940792322 2:158042343-158042365 CAGGGGATGTTATGGCTTATGGG - Intronic
942163828 2:173221337-173221359 CAGGAGCTGTGATGCATTCTGGG + Intronic
944748788 2:202686289-202686311 CTGGAGCTGTAATGCATTGTTGG + Intronic
948525197 2:238567088-238567110 CAGGGCCTGGGACACATTATGGG - Intergenic
1173195976 20:40913182-40913204 CAGGGGCTGTGAATTATTAGAGG - Intergenic
1174063600 20:47849267-47849289 CGCAGGCTGTGATGCATTAGTGG - Intergenic
1174072104 20:47906392-47906414 CACAGGCTGTGATGCATTAGTGG + Intergenic
1174151942 20:48492281-48492303 CACAGGCTGTGATGCATTAGTGG - Intergenic
1175017357 20:55806435-55806457 CAGGGTCTGTGAGGTTTTATAGG + Intergenic
1176658623 21:9613085-9613107 CAGGGGCTGTTATCCAGAATTGG - Intergenic
1179251839 21:39677349-39677371 CAGGAGCTGTGATGCATGATAGG - Intergenic
1179986351 21:44922772-44922794 CAGGTGCTGTGATTCCTGATGGG - Intronic
1182962766 22:34491076-34491098 CAGGTGCTTTGATTCATTAGCGG + Intergenic
950098563 3:10344037-10344059 CAGGGGCTGTGATGAAACCTGGG - Intronic
950213014 3:11137606-11137628 CATGGGCTGTGATGGCTGATTGG + Intronic
959256280 3:104019161-104019183 CAGCAGCTGTGCTGTATTATGGG - Intergenic
959579764 3:107971387-107971409 CAGTGGATGGGATGCAGTATTGG - Intergenic
959787095 3:110312739-110312761 CAGGGGCTGTTATTCTTTATGGG + Intergenic
960222241 3:115127464-115127486 CAGTAGCTGGGATGGATTATAGG - Intronic
960575832 3:119228438-119228460 GAGGGACAGTGATGCATTACTGG - Intronic
964381928 3:156106060-156106082 AAGAGTCTGTGCTGCATTATGGG + Intronic
965267624 3:166565446-166565468 CAAGGGGTGTGAGACATTATAGG - Intergenic
969874114 4:10123467-10123489 CAGGAGCTGTGATGGATTTGTGG - Intergenic
971501957 4:27327775-27327797 CAGGGCCTGTGCTGCATTATAGG + Intergenic
972190297 4:36583458-36583480 CAGGGCCAGTGATTCATTAAAGG - Intergenic
973284823 4:48403491-48403513 CAGCAGCTGTGCTGCATTGTGGG + Intronic
973832735 4:54778551-54778573 CAGGGGCTGTGGAGCAACATGGG - Intergenic
975806755 4:78120725-78120747 CACGGGCAGTGAATCATTATGGG - Intronic
984839744 4:184057172-184057194 CAGGGGGTGGGAGGCGTTATTGG + Intergenic
985260303 4:188108656-188108678 GAAGGGCTGTGATGAATTAGAGG - Intronic
985384648 4:189433011-189433033 GTGGGGCTGTAATGCATGATTGG + Intergenic
985416783 4:189742982-189743004 CAGGGGCTGTTATCCAGAATTGG + Intergenic
986753561 5:10812371-10812393 CAGCAGCTGTGCTGCATTGTGGG - Intergenic
988242853 5:28636074-28636096 AAGGGGCTATATTGCATTATTGG + Intergenic
994344137 5:98664748-98664770 CAGCCGCTGTGCTGCATTGTGGG - Intergenic
995587168 5:113660104-113660126 CTGTGGCTGTGATGCATTTGTGG - Intergenic
998909427 5:146942631-146942653 CAGGAGTTCTCATGCATTATTGG - Intronic
999415239 5:151389350-151389372 CAGGGGACGGGAGGCATTATAGG - Intergenic
1006046285 6:31301529-31301551 CAGCGTGTGTGATGCAGTATGGG - Intronic
1006460661 6:34155739-34155761 CAGGCGCTGCCAGGCATTATAGG + Intergenic
1010282935 6:74041360-74041382 GAGGGGGTGTGCTGCATTAGGGG + Intergenic
1010642259 6:78342967-78342989 CAGGTACTGTGATATATTATAGG - Intergenic
1013636605 6:112034738-112034760 CAGAGGCTGTAATGCAGTTTAGG + Intergenic
1017686452 6:156918211-156918233 CAGAGGCTGTGATCCATTGTGGG + Intronic
1018570568 6:165205337-165205359 CAGTGGCTTTGATGCCATATGGG + Intergenic
1019924851 7:4185427-4185449 CAGGGGCTGAGATGCCTGCTTGG - Intronic
1022381385 7:29863243-29863265 CAGTGGCTGCCATGGATTATGGG - Intronic
1024821443 7:53335394-53335416 CAGAGGCTGGGAAGCATTGTGGG + Intergenic
1035314615 7:157990367-157990389 CAGGTGCCGTGATGCATTCCTGG - Intronic
1038074454 8:24056221-24056243 CAGAGTATGTGATTCATTATTGG + Intergenic
1038785869 8:30615695-30615717 CAGGAGCTGTCATTCATTACTGG + Intronic
1038918194 8:32051241-32051263 CAGAGGTTGTTATACATTATTGG - Intronic
1042573863 8:70196550-70196572 CAAGGCCTCTGAGGCATTATAGG - Intronic
1043515042 8:80988244-80988266 CAGGTGCTGTAAATCATTATTGG + Intronic
1046986812 8:120397570-120397592 CAGCAGCTGTGTTGCATTGTGGG - Intronic
1048970873 8:139644424-139644446 CGTGGGCTGTGATCCATTAATGG - Intronic
1055042010 9:71884352-71884374 CAGGGCCTGAGATGCAATATAGG + Intronic
1059004224 9:110383893-110383915 CAGCTGCTGTGCTGCACTATGGG + Intronic
1059943133 9:119377470-119377492 CAGGGATTGGGATGTATTATGGG - Intergenic
1203636350 Un_KI270750v1:116664-116686 CAGGGGCTGTTATCCAGAATTGG - Intergenic
1187014074 X:15308621-15308643 CAGTGGTTGTCATGCATTTTGGG - Intronic
1187240528 X:17509006-17509028 CAGGGACAGTGCTGTATTATAGG - Intronic
1188661052 X:32759084-32759106 CAAGGGCTGTGATGGAAAATAGG - Intronic
1191815610 X:65241341-65241363 CAGCAGCTGTGCTGCATTGTGGG + Intergenic
1191938612 X:66453436-66453458 CAGGGACTGGGATGGAATATTGG + Intergenic
1193192279 X:78585298-78585320 CAGAGGCTGTCAAGCATAATGGG - Intergenic
1193510845 X:82397456-82397478 CAAAGGCTGTGATGCATTTAGGG + Intergenic
1196635768 X:118000854-118000876 CTGGGGCTGTTATGTAATATAGG + Intronic
1197391460 X:125871716-125871738 CAGAGGCTGTGATGAGTAATGGG - Intergenic
1197522620 X:127519311-127519333 CAGTAGCTGTGCTGCATTGTGGG - Intergenic
1197522661 X:127519572-127519594 CAGCAGCTGTGCTGCATTGTGGG - Intergenic