ID: 1143930244

View in Genome Browser
Species Human (GRCh38)
Location 17:10415137-10415159
Sequence CTTTGGTACTACAGGGAAGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 139}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143930244 Original CRISPR CTTTGGTACTACAGGGAAGC TGG (reversed) Exonic
906046576 1:42835610-42835632 CCTTGTCACTACAGGTAAGCGGG - Intronic
909269423 1:73603303-73603325 CTTTGGAAATACAGAGAAGGCGG - Intergenic
912105566 1:106269194-106269216 CATTGGTACTACAGGATAGGAGG - Intergenic
913056353 1:115164866-115164888 CTTTGGTACAATATGGAAGAGGG + Intergenic
919472985 1:198001653-198001675 GTTTAGCACTACAGGGAAGTGGG - Intergenic
919881496 1:201904047-201904069 CTTGAGTACTCCAGGGATGCTGG - Intronic
922081586 1:222302837-222302859 CTTTGGAACCAAAGAGAAGCTGG + Intergenic
922739925 1:228009036-228009058 CTTTGGCCACACAGGGAAGCGGG + Intronic
924272725 1:242350524-242350546 CTTTGGTGATAAAGTGAAGCCGG - Intronic
1063468764 10:6267409-6267431 CTTGGCTAATACAGGGAAGTAGG + Intergenic
1068590590 10:58849013-58849035 CTTTGGGAGTACAGAGAAGGAGG - Intergenic
1069869781 10:71526131-71526153 CTTTGGTGCTACAAGAAAGCCGG + Intronic
1071317836 10:84420430-84420452 GTTTGGTACTATAGGAAAGTGGG + Intronic
1073897250 10:108176945-108176967 CTTAGGTAATACAGAGAAGATGG - Intergenic
1073999247 10:109352176-109352198 TTTTGGTACCACGGGGAGGCTGG + Intergenic
1075065857 10:119288459-119288481 CTTTGGGGAAACAGGGAAGCAGG - Intronic
1078529719 11:12127615-12127637 CTTTGGGAGCACAGGGAAGGAGG + Intronic
1080216940 11:29854467-29854489 TTTTGGTATTAGAGTGAAGCTGG - Intergenic
1080395593 11:31886916-31886938 TTCTTTTACTACAGGGAAGCTGG - Intronic
1083892833 11:65605394-65605416 ATTTGGTACCCAAGGGAAGCTGG - Intronic
1083902658 11:65651099-65651121 ATTTGGTTCTGCAGGGAAGCAGG + Intergenic
1084776430 11:71379979-71380001 TTCTGGTTCTACTGGGAAGCAGG + Intergenic
1092126619 12:6079247-6079269 CTGTGGCAGAACAGGGAAGCTGG - Intronic
1092259746 12:6946470-6946492 CTTTGGGGCTGCAGGGAAGCTGG + Intronic
1093233173 12:16574028-16574050 ATTTGTTACTTCGGGGAAGCGGG - Intronic
1093538254 12:20248384-20248406 CTTTTCTACTACAGCCAAGCTGG - Intergenic
1093643011 12:21550204-21550226 ATTTGCTACTAAAGGGAACCAGG - Intronic
1094221156 12:27995064-27995086 CTTTGGATGTATAGGGAAGCAGG - Intergenic
1094721722 12:33072186-33072208 CTTTGGTACTACGGTGATGCTGG + Intergenic
1097958178 12:65507404-65507426 CCTTGGTACTAGCAGGAAGCAGG - Intergenic
1102961422 12:117095961-117095983 CTGTGGGACTGCAGGCAAGCTGG + Intronic
1110176697 13:72565307-72565329 CTCTGGGACTATAGGGATGCTGG - Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1113730873 13:112640772-112640794 CTTTGGGACTTCAGGGAGCCAGG - Intergenic
1117163413 14:53011097-53011119 CTTAAGTAAGACAGGGAAGCGGG - Intergenic
1118994469 14:70823376-70823398 CTTTGGGACTACTGAGAACCAGG - Intergenic
1119146413 14:72318794-72318816 ATTTGCTACTACATGGTAGCAGG - Intronic
1119262364 14:73245442-73245464 TGTTGGTACTCCAGAGAAGCGGG - Intronic
1122179036 14:99942258-99942280 CTTACGTGCTGCAGGGAAGCTGG - Intergenic
1123977241 15:25564941-25564963 CTTCAGAGCTACAGGGAAGCCGG - Intergenic
1124848923 15:33317233-33317255 CTCTGGTTTTACAGGAAAGCAGG - Intronic
1128880951 15:71242510-71242532 CTATGGTAGAACTGGGAAGCAGG - Intronic
1129057095 15:72827947-72827969 CTTTGGGACTTCATGGCAGCTGG + Intergenic
1135389607 16:22079472-22079494 CTTTGGTAGCACAAGGGAGCAGG + Intronic
1135400772 16:22164900-22164922 CTTTGGTACTCCATGGAAACTGG + Intergenic
1135568205 16:23528338-23528360 CAATGGCACTGCAGGGAAGCAGG + Intronic
1139340266 16:66263860-66263882 CTCTGGTATGGCAGGGAAGCCGG - Intergenic
1140733082 16:77873970-77873992 CTCTGGTTCTGCAGAGAAGCAGG - Intronic
1143082416 17:4391668-4391690 GTTTGGAACTACATGGCAGCTGG - Intergenic
1143232830 17:5371992-5372014 CTTTAGTACTACAGATTAGCAGG + Intronic
1143930244 17:10415137-10415159 CTTTGGTACTACAGGGAAGCTGG - Exonic
1143938573 17:10513647-10513669 CTTCGGTACCACAGGGAAACTGG - Exonic
1143941165 17:10543119-10543141 CTTTGGCACTACTGGAAAACTGG - Exonic
1143952845 17:10647384-10647406 TTTTGGAACCACTGGGAAGCTGG - Exonic
1144441657 17:15287967-15287989 CATTGGTTCTACAGGCAAACAGG + Intergenic
1144642783 17:16947115-16947137 TTTTGGTACCAGAGTGAAGCTGG - Intronic
1146485358 17:33238317-33238339 CTCTGGGACTCCAGGGAGGCTGG + Intronic
1146726811 17:35162873-35162895 CTTGTGTAGTACAGGGAAGTGGG - Intronic
1146921090 17:36712532-36712554 CCTTGGTACTACATTCAAGCAGG + Intergenic
1149865391 17:60148666-60148688 CTTTGATCCTACAGAGAGGCAGG - Intergenic
1153965626 18:10178938-10178960 TTTTGGTACTAGAGTGATGCTGG + Intergenic
1155019780 18:21885432-21885454 CTTTGGTATTAGGGTGAAGCTGG + Intergenic
1159559549 18:69978930-69978952 CTCTGGTATTACAAGGAACCAGG + Intergenic
1160232231 18:77057059-77057081 CCTGGGTACTACAATGAAGCAGG + Intronic
929044473 2:37776589-37776611 CTTTGGTACAGCAGGGGAGAAGG + Intergenic
929490931 2:42395456-42395478 CTTTGGGACTACAGGTGCGCAGG + Intronic
930142832 2:47970482-47970504 CTTTGGTAGTCCAGGGCAGGAGG - Intergenic
930232927 2:48860783-48860805 ATTTCCTACTACAGGGACGCAGG + Intergenic
936067133 2:109340850-109340872 CTTTGATGCAACAGGGAAACAGG + Intronic
938880476 2:135581271-135581293 CTGTGGATCTACAGGGAAACAGG - Intronic
942828477 2:180209847-180209869 CATTGGTACTATAGTGAAGGTGG + Intergenic
944153985 2:196592625-196592647 GTTTGGTTCTCCAGGGAAACTGG - Intronic
945434941 2:209808677-209808699 CTTAAGTACTCCAGGGGAGCAGG - Intronic
945824130 2:214699376-214699398 GTTTATTACTACAGGGGAGCTGG + Intergenic
948764490 2:240212470-240212492 CCTTGGTCCTGCAGGGAGGCTGG + Intergenic
1170330791 20:15208640-15208662 CTTTGACACTCCAGGGAGGCAGG + Intronic
1170522584 20:17202847-17202869 CTTTGCTTATACAGGGAACCTGG + Intergenic
1171088889 20:22265768-22265790 GTCTGGCACTGCAGGGAAGCTGG + Intergenic
1171380688 20:24731833-24731855 CTCTGACTCTACAGGGAAGCAGG + Intergenic
1171570654 20:26247594-26247616 TTTTGATACTATAGGGAACCAGG + Intergenic
1172444312 20:34985086-34985108 CTTTGGTCCCTCTGGGAAGCTGG + Exonic
1174537222 20:51260594-51260616 CATAGGTAATCCAGGGAAGCGGG - Intergenic
1175971847 20:62690288-62690310 CTTTGATACTCCAGGGGAGTGGG + Intergenic
1178031544 21:28532773-28532795 CTTTGGTATTAGAGTGAAGCTGG + Intergenic
1179410943 21:41162774-41162796 CTTTGGGACCAGAGGGAAGTAGG - Intergenic
1179982101 21:44900961-44900983 CGCTGGGACTGCAGGGAAGCAGG + Intronic
1180572815 22:16744606-16744628 TTTTGATACTATAGGGAACCAGG + Intergenic
1184230660 22:43156759-43156781 CCTTGATACGACATGGAAGCTGG - Intronic
950822629 3:15777369-15777391 ATTTGGTTCTACACGGAATCAGG + Intronic
952404864 3:32996888-32996910 CTTTGGCACTGCAGGGATGCAGG + Exonic
952959390 3:38580094-38580116 CTCTGGGACCACAGGGAGGCAGG + Intronic
954380277 3:50215578-50215600 CTTTGGGACCCCAGGAAAGCTGG + Exonic
954421564 3:50421623-50421645 CCTTGGTACTACAGGGACACAGG + Intronic
957104880 3:75874308-75874330 TTTTGATACTATAGGGAACCAGG - Intergenic
958490307 3:94764451-94764473 TTTTGGTACTAGAGTGATGCTGG + Intergenic
958688782 3:97433789-97433811 GTTTGGTACTGCAGGGGATCTGG - Intronic
961460144 3:127045001-127045023 CTTCTGTCCTACTGGGAAGCAGG - Intergenic
961785703 3:129345300-129345322 CTTTGGTTCCACAAGGAAGATGG - Intergenic
962984011 3:140518105-140518127 CTTTTGGGCTACATGGAAGCTGG - Intronic
963670568 3:148247075-148247097 CTATGATACTACAAGGAAGAGGG - Intergenic
964389676 3:156184335-156184357 TTTTGGTACAACAGGGAGCCTGG - Intronic
964778316 3:160305833-160305855 CTTTGTTACTAAAGGAAAGCAGG - Intronic
964808679 3:160639339-160639361 CATTGGTACTAGATAGAAGCAGG - Intergenic
969256631 4:6006925-6006947 CTTTGGTGCTACAGGTAAAGTGG + Intergenic
969595723 4:8148362-8148384 CTCTGGGCCTACAGTGAAGCAGG + Intronic
971917024 4:32884458-32884480 TGTTGGTACTACAGGGCAGAAGG + Intergenic
973185239 4:47319671-47319693 CTTTGGAATTAGAGTGAAGCTGG + Intronic
977616521 4:99092794-99092816 CTTTGGTATTACAGTAATGCTGG - Intergenic
981400632 4:144310033-144310055 TTTTGGTATTACAGTGATGCTGG + Intergenic
982103279 4:151989523-151989545 CTGTGTAACCACAGGGAAGCAGG - Intergenic
984055129 4:174918831-174918853 ATTTGTTACTACAGAGAAGTGGG - Intronic
985085151 4:186305642-186305664 CTTTGGTGCTCCAGGGTTGCCGG + Intergenic
989317226 5:40095598-40095620 CTTCTGTATTACAGGAAAGCTGG - Intergenic
991142399 5:63259950-63259972 CTTTTGTTCCACAGGGAAGAAGG + Intergenic
991324636 5:65416883-65416905 TTTTGGTATTACAGTGATGCTGG - Intronic
993970041 5:94408173-94408195 CTTTGGGACTAGATGGGAGCAGG + Intronic
1000750672 5:165092341-165092363 TGTTGCTACAACAGGGAAGCAGG + Intergenic
1001166107 5:169369470-169369492 CTTTGGTATTAGAGTGAAACAGG - Intergenic
1003421663 6:5963795-5963817 CTTCGGTACTCCAGGGTAGCTGG - Intergenic
1008423196 6:51327118-51327140 CTTTGGTATTAAAGGCAGGCTGG - Intergenic
1010809964 6:80289922-80289944 CTCTAGTCCCACAGGGAAGCTGG - Intronic
1011823217 6:91276516-91276538 CTTTGCCACTAGAGGGAAGAAGG + Intergenic
1011963671 6:93124439-93124461 CTTTTGTGCCACAGGGAAGGAGG - Intergenic
1013343187 6:109235664-109235686 CCTTGGTACTATAGGGAGGCTGG + Intergenic
1014311058 6:119801976-119801998 CTTTGGAAAAACACGGAAGCTGG + Intergenic
1017255495 6:152328851-152328873 CTGCTGTGCTACAGGGAAGCAGG + Intronic
1018439141 6:163793052-163793074 GTTTTGTTCTACAGGGAAGGAGG - Intergenic
1020263894 7:6547644-6547666 CTTTGGTGATGTAGGGAAGCTGG + Intronic
1021297635 7:18928105-18928127 CTATTTTACTACAGGGAGGCAGG + Intronic
1023039503 7:36160031-36160053 CTTTTGTTTTACAAGGAAGCTGG + Intronic
1028343161 7:89747265-89747287 CTTTGGTCCTCAAGGGAATCTGG + Intergenic
1029253445 7:99252833-99252855 CTTTGGAACCACAGGGAAACTGG + Intergenic
1031058106 7:117016304-117016326 GTGTGGTACTACATTGAAGCAGG + Intronic
1036686774 8:10917046-10917068 CTTTGCTAAGACAGGGAAGCAGG - Intronic
1039002276 8:32995035-32995057 CTGTTGTACTGCAGAGAAGCTGG + Intergenic
1039836205 8:41258348-41258370 CTCAGGCACTCCAGGGAAGCGGG + Intergenic
1050146112 9:2569420-2569442 CCTTGGAACAACATGGAAGCAGG - Intergenic
1050498759 9:6271981-6272003 CTTTGGTACTAGAGAGATCCTGG + Intergenic
1052009204 9:23385952-23385974 CTGGGGGACTACAGGGAAGGTGG + Intergenic
1055103598 9:72490424-72490446 CATTGGTATTTCTGGGAAGCAGG - Intergenic
1055370616 9:75594231-75594253 CTTGGGTAGTAAAGAGAAGCTGG - Intergenic
1058753934 9:108066650-108066672 CTTTGGAAGTCCAGGGCAGCTGG - Intergenic
1061119862 9:128635925-128635947 CTGGGGTACAACAGGGGAGCTGG - Intronic
1061675388 9:132212702-132212724 CTTGGGCACTAGAGGGAAGGAGG - Intronic
1186264396 X:7816493-7816515 GTTTGGTATTACAGAGAAGTTGG - Intergenic
1189962389 X:46336519-46336541 TTTTGGTATTACAGTGATGCTGG - Intergenic
1192355772 X:70401857-70401879 GTTTGGTACTATAAGGAAGATGG - Intronic
1192591536 X:72363986-72364008 CCTTGGTTCAACAGGGAAGCAGG + Intronic
1194100204 X:89694176-89694198 GTCTAGTACAACAGGGAAGCCGG + Intergenic
1194841915 X:98753687-98753709 CTATTGTACTACAACGAAGCTGG + Intergenic
1194874304 X:99167340-99167362 CTTTGGTATTACAGTGATACTGG - Intergenic
1196625397 X:117871788-117871810 CTTTTGTACTACAGTTGAGCGGG - Intergenic
1196924178 X:120615947-120615969 TTTGGGTACGACAGGGAACCTGG - Intronic
1200453202 Y:3355535-3355557 GTCTAGTACAACAGGGAAGCCGG + Intergenic
1202043912 Y:20717576-20717598 TTTTGGTACTAGAGGGATGGTGG - Intergenic