ID: 1143932314

View in Genome Browser
Species Human (GRCh38)
Location 17:10442061-10442083
Sequence CTCCTTTTCTGGAGCAAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143932311_1143932314 11 Left 1143932311 17:10442027-10442049 CCTTAAAATATGCAAGATACTGA No data
Right 1143932314 17:10442061-10442083 CTCCTTTTCTGGAGCAAAAATGG No data
1143932310_1143932314 14 Left 1143932310 17:10442024-10442046 CCTCCTTAAAATATGCAAGATAC No data
Right 1143932314 17:10442061-10442083 CTCCTTTTCTGGAGCAAAAATGG No data
1143932309_1143932314 25 Left 1143932309 17:10442013-10442035 CCTTTATGGTTCCTCCTTAAAAT No data
Right 1143932314 17:10442061-10442083 CTCCTTTTCTGGAGCAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143932314 Original CRISPR CTCCTTTTCTGGAGCAAAAA TGG Intergenic
No off target data available for this crispr