ID: 1143932741

View in Genome Browser
Species Human (GRCh38)
Location 17:10447123-10447145
Sequence GCGCAGAGCTAACCTGATGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 5, 3: 6, 4: 54}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143932741_1143932745 13 Left 1143932741 17:10447123-10447145 CCTGCATCAGGTTAGCTCTGCGC 0: 1
1: 0
2: 5
3: 6
4: 54
Right 1143932745 17:10447159-10447181 GTTGTTCCTTAAGGTCATCTTGG 0: 1
1: 0
2: 0
3: 7
4: 125
1143932741_1143932747 23 Left 1143932741 17:10447123-10447145 CCTGCATCAGGTTAGCTCTGCGC 0: 1
1: 0
2: 5
3: 6
4: 54
Right 1143932747 17:10447169-10447191 AAGGTCATCTTGGCCTCTGATGG 0: 1
1: 0
2: 0
3: 19
4: 151
1143932741_1143932743 4 Left 1143932741 17:10447123-10447145 CCTGCATCAGGTTAGCTCTGCGC 0: 1
1: 0
2: 5
3: 6
4: 54
Right 1143932743 17:10447150-10447172 CCATTGCCAGTTGTTCCTTAAGG 0: 1
1: 0
2: 2
3: 28
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143932741 Original CRISPR GCGCAGAGCTAACCTGATGC AGG (reversed) Exonic
902190719 1:14761168-14761190 GCACAGACCTAGCCTGCTGCAGG - Intronic
907585314 1:55611704-55611726 GGGGAGAGCCTACCTGATGCAGG - Intergenic
1064632288 10:17328803-17328825 GCGCAGAACGAACCTGACCCTGG + Intronic
1066610639 10:37244610-37244632 CAGCAGAGGTAACCTGATGAAGG - Intronic
1074144895 10:110709130-110709152 GGACAGAGCTATCCTGATGCAGG + Intronic
1079456464 11:20640550-20640572 GCACAGAGTCAACCTGATTCTGG - Intronic
1086666631 11:89491458-89491480 GGGCAGAGCTGACCCGGTGCGGG - Exonic
1089012697 11:115143765-115143787 GCCCAAAGCTAACCAGAAGCTGG + Intergenic
1089181944 11:116589347-116589369 TCGCAGGGCTAACATGGTGCCGG + Intergenic
1090829811 11:130413391-130413413 GTACAGAGCTTACCTGGTGCAGG + Intronic
1091782474 12:3222670-3222692 GCCAAGAGCATACCTGATGCAGG + Intronic
1102556416 12:113729629-113729651 GCTCAGAGCTCACCTGCAGCTGG + Intergenic
1113660630 13:112104605-112104627 GCGCAGAGCGACCCTGGAGCTGG - Intergenic
1120200084 14:81528290-81528312 ACTCAGAGATAACCAGATGCAGG + Intronic
1122080418 14:99263199-99263221 GTGCAGAGCTGACCTGGAGCAGG - Intronic
1122375932 14:101257434-101257456 GCCCAGGGCTCACCTGATGCAGG - Intergenic
1122614911 14:103010594-103010616 GGGCAGAGCACACCTGCTGCTGG + Intronic
1123109467 14:105858980-105859002 GAGCAGAGCTAAGCCGAGGCTGG - Intergenic
1123109542 14:105859370-105859392 GAGCAGAGCTAAGCCGAGGCTGG - Intergenic
1123109554 14:105859421-105859443 GAGCAGAGCTAAGCCGAGGCTGG - Intergenic
1136624435 16:31453407-31453429 GCCCAGAGCTAAGCAGAAGCAGG + Intergenic
1141676693 16:85521517-85521539 GCCCAGAGCTGAACTGCTGCAGG - Intergenic
1143928424 17:10394359-10394381 GCGCAGAGCCAACCTGCTGCAGG - Exonic
1143932741 17:10447123-10447145 GCGCAGAGCTAACCTGATGCAGG - Exonic
1143936965 17:10496060-10496082 GCGCAGAGCCAACCTGCTGCAGG - Exonic
1143939421 17:10524576-10524598 GCGCAGAGCCAACCTGCTGCAGG - Exonic
1143950980 17:10631923-10631945 GCGCAGAGCCAACCTGCTGCAGG - Exonic
1155507470 18:26547747-26547769 GCGCAGCGCCAACCTGACGCTGG - Intronic
1159912772 18:74162090-74162112 GAGCAGAGCTGACCAGAGGCAGG + Intergenic
1162800498 19:13107724-13107746 GGGCAGGGCTGACCTCATGCAGG - Intronic
1168580561 19:57552459-57552481 GCTCAGTGCTCACCTGATGATGG + Intronic
925083782 2:1091561-1091583 CCGTAGCCCTAACCTGATGCGGG - Intronic
926707476 2:15846952-15846974 GGGCAGACCTCACCTGCTGCAGG + Intergenic
932050122 2:68389757-68389779 GGGCAGAGCCAGCCTTATGCCGG + Intronic
942139741 2:172965997-172966019 GTGCATAGCAATCCTGATGCAGG + Intronic
942448288 2:176092706-176092728 GCGATGAGCTAACCTGTTGGAGG + Intergenic
1178919605 21:36729834-36729856 GGCCAGAGCGATCCTGATGCGGG + Intronic
949120102 3:374330-374352 GCGGAGACCTAACCTGAGGCTGG - Intronic
960957095 3:123040504-123040526 CTGCAGAGCTAACCTGAGACTGG + Intergenic
961362946 3:126379597-126379619 ACAGGGAGCTAACCTGATGCAGG - Intergenic
961363103 3:126380362-126380384 TCACAGAGCTAACCTGATGCAGG - Intergenic
961599908 3:128052505-128052527 GAGCAGAGCTGAGCTGAAGCGGG + Exonic
966853819 3:184180641-184180663 GGGAAGAGCTTACCTGATGCTGG - Exonic
966971597 3:185049965-185049987 GGGCAGAGCTTAGCTGAGGCTGG - Intronic
968754178 4:2406530-2406552 GCGCCGTGCTTACCTGATACAGG + Intronic
971753903 4:30683522-30683544 ACACAGAGCTAAACTGTTGCAGG - Intergenic
981222024 4:142248148-142248170 GCACAGAGCTAACCTGATCTTGG - Intronic
985754406 5:1704569-1704591 GCGCAGAGCTGACCAGGTGGAGG + Intergenic
997969852 5:138392182-138392204 GCGCAGTGCTGAGCTGTTGCTGG + Exonic
998111031 5:139502843-139502865 GCCCAGATCTAGCCTGATGTGGG - Intergenic
998139735 5:139693111-139693133 TTGCAGCGCTGACCTGATGCAGG + Intergenic
998991653 5:147823830-147823852 GTGCTGTGCTAACCTGAGGCAGG - Intergenic
1002670227 5:180860936-180860958 GAGCAGACCTAACATGACGCTGG + Intronic
1024518012 7:50276940-50276962 CCGCAGAGGTACCATGATGCAGG + Intergenic
1029016193 7:97317203-97317225 GCCCAGAGCAAACTGGATGCTGG - Intergenic
1032361975 7:131264588-131264610 GGGCAGAGTTTACCTGATGTGGG - Intronic
1032491316 7:132326559-132326581 GGGCAGAGCAGCCCTGATGCAGG - Intronic
1033545761 7:142398841-142398863 GCCCAGAACTCACCTGATCCTGG - Intergenic
1034422897 7:150998626-150998648 GCACAGAGCCATCCTGCTGCCGG - Exonic
1036082633 8:5574211-5574233 GTCCTGAGCTAACCAGATGCAGG + Intergenic
1040816294 8:51511682-51511704 CCGCAGAGCCACCCTGATCCAGG + Intronic
1047759215 8:127941841-127941863 GCCCAGAGCTGAGCTGGTGCTGG - Intergenic
1049344699 8:142132574-142132596 GTGCAGAGACAGCCTGATGCTGG + Intergenic
1053021750 9:34700000-34700022 GCAGAGAGCTGACCTGATGAAGG + Intergenic
1055729212 9:79263363-79263385 GCAAAGACCTAACTTGATGCAGG + Intergenic
1199553052 X:149078356-149078378 GGGGAGAGAAAACCTGATGCTGG + Intergenic