ID: 1143932861

View in Genome Browser
Species Human (GRCh38)
Location 17:10448828-10448850
Sequence CAGTTTCCCCCAAGGGGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 4, 3: 11, 4: 156}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143932855_1143932861 22 Left 1143932855 17:10448783-10448805 CCTGGAAGTATATAGAAAATAAG 0: 1
1: 0
2: 1
3: 29
4: 351
Right 1143932861 17:10448828-10448850 CAGTTTCCCCCAAGGGGAGCTGG 0: 1
1: 0
2: 4
3: 11
4: 156
1143932854_1143932861 28 Left 1143932854 17:10448777-10448799 CCAGAACCTGGAAGTATATAGAA 0: 1
1: 0
2: 0
3: 16
4: 195
Right 1143932861 17:10448828-10448850 CAGTTTCCCCCAAGGGGAGCTGG 0: 1
1: 0
2: 4
3: 11
4: 156
1143932856_1143932861 -1 Left 1143932856 17:10448806-10448828 CCTTTGAAACCAAGAATGATGTC 0: 1
1: 0
2: 1
3: 18
4: 205
Right 1143932861 17:10448828-10448850 CAGTTTCCCCCAAGGGGAGCTGG 0: 1
1: 0
2: 4
3: 11
4: 156
1143932857_1143932861 -10 Left 1143932857 17:10448815-10448837 CCAAGAATGATGTCAGTTTCCCC 0: 1
1: 0
2: 0
3: 13
4: 203
Right 1143932861 17:10448828-10448850 CAGTTTCCCCCAAGGGGAGCTGG 0: 1
1: 0
2: 4
3: 11
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143932861 Original CRISPR CAGTTTCCCCCAAGGGGAGC TGG Intronic
900363211 1:2299882-2299904 GAGACTCCCCCATGGGGAGCTGG + Intronic
900363632 1:2301617-2301639 CATCTTCCCCCTAGGGAAGCAGG + Intronic
901080504 1:6581166-6581188 CAGTTTCCCACAGAGGGAGGAGG - Exonic
901687041 1:10948723-10948745 CAGCCTCCCCCAGGGGAAGCAGG - Exonic
901839693 1:11946115-11946137 CAGTTTCCCCCTTGGAAAGCAGG - Intronic
901967994 1:12883695-12883717 TAGTTTCCCCCAATGGTAGGAGG - Intronic
903459428 1:23510080-23510102 CAGTAGCCTCCAAGGGGACCAGG + Exonic
904035555 1:27556934-27556956 CTGATGCCCCCAAGGGGAGCTGG + Intronic
904056283 1:27672508-27672530 CTGTGTGCCCCAGGGGGAGCTGG - Intergenic
904270691 1:29348084-29348106 CACTTTCTCCCATGGGGAGAGGG - Intergenic
906078324 1:43068164-43068186 CCCTTTCCCCCAAAGGGAACAGG - Intergenic
906793691 1:48679954-48679976 CAGTCTCTCCCCAGGGGAGGTGG - Intronic
907987225 1:59544025-59544047 CAGTTTGCCCCAAGATAAGCTGG + Intronic
909574640 1:77159733-77159755 CAATTTCTCCCAAGTGGAACAGG + Intronic
913042256 1:115038663-115038685 CACTCTCCCCAAAGGTGAGCGGG + Intergenic
920866253 1:209756389-209756411 CACTCTCCACCCAGGGGAGCTGG - Intronic
921770812 1:219037720-219037742 CTGTTTCCCACAATGGAAGCAGG - Intergenic
921985190 1:221305276-221305298 AAGTATCCCCCAAAGGCAGCTGG + Intergenic
1064066028 10:12182180-12182202 CAGTGTCCCCCCAGGGGAAAAGG - Intronic
1067837384 10:49650037-49650059 CCTTTTTCCCCAAGGGGAGGGGG + Intronic
1070647461 10:78211571-78211593 CAGTTTCCCCCAAAGCGCTCAGG - Intergenic
1071305163 10:84293317-84293339 CACATTCCCTGAAGGGGAGCTGG + Intergenic
1072738209 10:97893643-97893665 CAGTTTCACCCAATGGTTGCAGG + Intronic
1073677368 10:105663322-105663344 CAGTTTTCCCCATGGAGACCTGG - Intergenic
1076054354 10:127359187-127359209 CAGTGGTCCCCAAGGTGAGCAGG - Intronic
1076429678 10:130393003-130393025 CAGCCTCCCCCAAAGAGAGCTGG - Intergenic
1081775661 11:45674523-45674545 CAGTTTCACCCCAGGGAATCTGG - Intergenic
1084064711 11:66697181-66697203 CAGTTACCCCCATGGGCATCAGG - Intronic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1084507339 11:69576379-69576401 CAGTTGGCCCCAAGAGGAACTGG + Intergenic
1084620665 11:70268401-70268423 CAGGTACCCCTAAGGAGAGCTGG + Intergenic
1084620987 11:70270405-70270427 CAGTTTCCCCCCACGGCTGCAGG - Intergenic
1087060055 11:93968510-93968532 CACTTACCTCCAAGGGAAGCTGG - Intergenic
1090179743 11:124685835-124685857 CAGTTTCTCCCATTTGGAGCAGG + Intronic
1090807581 11:130212013-130212035 CAGATTCCCACCCGGGGAGCAGG + Intergenic
1091748486 12:3008244-3008266 CAGTGGCACCCAAGGGGTGCAGG + Intronic
1092887400 12:12937032-12937054 CAGTTTCCCACAGAGGAAGCAGG + Intergenic
1097351643 12:58555686-58555708 CAGCATCTCCCAAGGAGAGCTGG + Intronic
1098321448 12:69248455-69248477 AAGTTTCCCACAAGGGGTGTTGG - Intronic
1098897501 12:76080900-76080922 CAGTTTCCCACCAGGGGAGCTGG + Intronic
1100855329 12:98752656-98752678 CAGTTAGCCCCAGGAGGAGCAGG + Intronic
1102313482 12:111866011-111866033 AACTTGCCCCCAAGGGTAGCAGG - Intronic
1104448696 12:128853083-128853105 CAGTCCCTCCCAAGGGGACCAGG - Intergenic
1104977705 12:132559715-132559737 CAGTTTCCCCTTCTGGGAGCGGG + Intronic
1109528936 13:63614760-63614782 CACTTTCCCACAATGGGAACTGG - Intergenic
1112432154 13:99359599-99359621 CAGTTGCCCCCAAGCGGGGAGGG - Intronic
1113654249 13:112058117-112058139 CTGTTTCCTGCAAGGGGAGGCGG - Intergenic
1119271420 14:73308359-73308381 CAAATTCCCCCAAGGAGAGAAGG - Intronic
1119974321 14:79008740-79008762 CAGTTTAACCCAAGGGGTGGAGG - Intronic
1120979617 14:90278580-90278602 AAGTCTCAGCCAAGGGGAGCAGG - Intronic
1121011797 14:90524227-90524249 CAGTTTCCCCAACGGGGAAGTGG - Intergenic
1122538844 14:102485332-102485354 TAGTTTCTCTCAAAGGGAGCTGG - Intronic
1126044908 15:44630284-44630306 GGTTTTCCCCCTAGGGGAGCAGG + Intronic
1126915335 15:53460115-53460137 CAGTGTTCCCCAAGGGGAAGGGG - Intergenic
1128731440 15:70024141-70024163 CTGTCTCCCCCAAGGGGACTGGG + Intergenic
1129140912 15:73597127-73597149 CAGAGTCCTCCAAGGTGAGCCGG + Exonic
1130520758 15:84658900-84658922 CAGATTCCCCCAAAGGGCGGAGG - Intergenic
1131680140 15:94712943-94712965 CAGTTTCTACAAAGTGGAGCAGG - Intergenic
1132882907 16:2170287-2170309 CACATTCCCCCACGGGAAGCAGG + Intronic
1134685685 16:16156575-16156597 CACTTTACCCCAAGGGAAGCTGG + Intronic
1134688792 16:16177392-16177414 CCTTTTCCCCCAAGGGTGGCAGG + Intronic
1136239030 16:28932986-28933008 GAGCTTCCCGGAAGGGGAGCTGG - Exonic
1141665804 16:85464570-85464592 CTGTTTCCCCCGAGGGGTGATGG + Intergenic
1141720561 16:85753024-85753046 CAGTTTCCTCAAAGGAGAACTGG + Intergenic
1143672250 17:8404964-8404986 CAGTGTCCCTCCGGGGGAGCAGG - Intergenic
1143932861 17:10448828-10448850 CAGTTTCCCCCAAGGGGAGCTGG + Intronic
1146545940 17:33738552-33738574 CAGTTTCCCCCAGTGGTAGCTGG + Intronic
1148550671 17:48548797-48548819 AAATTTCCCCCAAGGGAAGAAGG - Intergenic
1149554108 17:57560907-57560929 CAGTTTCGCCCCAGTGGAACTGG + Intronic
1150805721 17:68317316-68317338 CAGTTTCTCCCAAAGGGATATGG - Intronic
1156892155 18:42203343-42203365 CAGTTTCCCACAAGATCAGCAGG - Intergenic
1161026963 19:2041361-2041383 CAGCTCCACCCAAGTGGAGCTGG + Intronic
1161029082 19:2049761-2049783 CAGTTTTCCCCTAGGGCAGCAGG - Intronic
929547678 2:42866386-42866408 CTGTTTTCCCCCATGGGAGCAGG + Intergenic
929842989 2:45490336-45490358 AATTTTCCCCCAAGGAAAGCTGG + Intronic
931640885 2:64380162-64380184 CAGTTACCACCGAGGGGAACTGG + Intergenic
934502124 2:94869916-94869938 CAGTTTCCCCAGATGGCAGCAGG - Intergenic
935145929 2:100395479-100395501 CAGCTTCCTCAAAGGGGAGGGGG - Intronic
935708408 2:105876432-105876454 CTGTTGACCCCAAGGTGAGCAGG + Intronic
937112618 2:119378230-119378252 CAGTTTCCCTAAAGGGGATGGGG + Intergenic
937937646 2:127258983-127259005 CAGTCACCACCAAGGTGAGCTGG + Intronic
938256236 2:129861911-129861933 CAGCTTCCCACCAGGGTAGCTGG + Intergenic
941473570 2:165920899-165920921 CAGTTTCACTCAAGGGAAGTTGG - Intronic
948748987 2:240118251-240118273 CACTTTCCTCAAAGGTGAGCTGG - Intergenic
948878065 2:240840777-240840799 CAGCCTCCCCCATGGGGAGGGGG - Intergenic
1169725542 20:8725133-8725155 CTGTTTCCCAGAAGGGAAGCAGG + Intronic
1172663387 20:36582765-36582787 CAGTTTCCATCAAGGAGGGCTGG - Intronic
1174377930 20:50138783-50138805 AAGCTGCCCCCAGGGGGAGCCGG - Intronic
1176623884 21:9075249-9075271 CAGTTTCCCCAGATGGCAGCAGG + Intergenic
1178261781 21:31106660-31106682 CAGTTTCTCCCATTTGGAGCAGG - Intergenic
1181749790 22:24981301-24981323 CTGGTGCCCCCAAGGAGAGCTGG + Intronic
1183075181 22:35422414-35422436 CAGTTTCCCCAGGAGGGAGCAGG + Intronic
1183406321 22:37632308-37632330 CAGGATCCCCGGAGGGGAGCTGG + Intronic
952493428 3:33894299-33894321 CAGTTTCACCCCAGGGATGCAGG - Intergenic
955600156 3:60636457-60636479 CACTTTCCACAAAAGGGAGCTGG + Intronic
959916589 3:111823233-111823255 CAGTTCCCCCTAATGAGAGCTGG + Intronic
962469812 3:135696463-135696485 CAGTTTCCTCCAATGGGAGCTGG - Intergenic
964195990 3:154065559-154065581 CTGTTTACCTCATGGGGAGCAGG - Intergenic
966592095 3:181695229-181695251 CCGTTTCGCCCACGGGGTGCGGG + Intergenic
968592543 4:1466175-1466197 CAGTTTGCTCCAAGTGCAGCAGG + Intergenic
968949519 4:3683401-3683423 GAGTTTGCAGCAAGGGGAGCAGG - Intergenic
969058103 4:4414484-4414506 CAGCTTCGGCCAAGGGCAGCTGG - Intronic
970990204 4:22204261-22204283 CAGGTTTTCCCAAGGGAAGCAGG + Intergenic
972200042 4:36703238-36703260 CAATTTACCCCATGGGGAACAGG + Intergenic
972607822 4:40630224-40630246 CAGATGCCCCCAGGTGGAGCAGG - Intronic
974205905 4:58703199-58703221 CACTTTCCCCAAAGTGGTGCTGG + Intergenic
976446951 4:85140877-85140899 GAGTTTGCGGCAAGGGGAGCGGG + Intergenic
982745923 4:159103798-159103820 CACTGTCCCCCGAGTGGAGCCGG + Intergenic
985574834 5:669253-669275 CAGCATCCCCCAGGGGGCGCTGG + Intronic
987722584 5:21657370-21657392 CAGTTTACCCCTCGTGGAGCTGG + Intergenic
992620342 5:78586144-78586166 CAGTTACCACCCATGGGAGCTGG - Intronic
992672569 5:79074953-79074975 CAGTTTCCCCCATGCTGAGGAGG + Intronic
996273852 5:121640605-121640627 CAGTTCACCTCAAAGGGAGCAGG + Intergenic
998095652 5:139394411-139394433 CAGAGTCCCCCAAGGGCGGCCGG - Exonic
998327002 5:141289725-141289747 CAGATTCCCCGAAGGAAAGCAGG - Intergenic
1000203004 5:159030490-159030512 CAGATTCCCTCCAGAGGAGCTGG + Intronic
1002542349 5:179914576-179914598 CAGAATCTCCCAAGGGGAGCTGG - Intronic
1003528353 6:6917100-6917122 CAGCTTCCCACCAGGGCAGCAGG - Intergenic
1006831360 6:36970235-36970257 CAGTTTACCCCAGGGGGTGCTGG + Intronic
1007160971 6:39791908-39791930 CAGTGTGTCCCAAGGGGTGCTGG - Intergenic
1011417496 6:87137793-87137815 CAGTCTTCCCCAGGGGAAGCTGG + Intergenic
1012624740 6:101392508-101392530 CAGTTTCCCCCAGAGGAAGTTGG - Intergenic
1014390271 6:120853573-120853595 CAGTGTCCTCCAAGTGGAACTGG - Intergenic
1016510013 6:144831790-144831812 CAGTGTCACCCAAGGGCAGATGG - Intronic
1018879212 6:167859439-167859461 CAGTTTCCTCCATGGGGAGTAGG + Intronic
1019729967 7:2624179-2624201 CAGGGTCCCCCAAGGGGACATGG + Intergenic
1019890112 7:3939753-3939775 CTCTTTCCACCAAGGGGAGCAGG - Intronic
1021963369 7:25894388-25894410 AACCTTCCCCCAAGGGGAGCTGG - Intergenic
1023560145 7:41465454-41465476 CAGTAACCCCCAAGGAGATCTGG + Intergenic
1024864984 7:53895667-53895689 CTGTTTCCCACTAGGGGATCTGG + Intergenic
1026593424 7:71715003-71715025 CAGCTTCCCCCCATGGGATCAGG + Intergenic
1029820365 7:103140940-103140962 AAATTTCCCACAATGGGAGCTGG + Intronic
1031020047 7:116617959-116617981 CAATTTTCCCCAAGGGAACCAGG - Intergenic
1032127557 7:129205836-129205858 GCGTTTACCCCAAAGGGAGCAGG + Intronic
1034509122 7:151519986-151520008 TTGTTTCCCCCAATGGGAGATGG - Intronic
1034939558 7:155221442-155221464 TCCTTTCCCCCAAGGTGAGCAGG + Intergenic
1034982690 7:155488873-155488895 CAGTGTCCCCCACAGGGAGGTGG - Intronic
1036077123 8:5514319-5514341 GAGTTTTCCTCAAGGGGACCTGG - Intergenic
1036134574 8:6148306-6148328 CAGTTTCCCCCAGTGTGAGAAGG - Intergenic
1037431760 8:18820670-18820692 CAGTTTCCACCAACTGGAGATGG - Intronic
1038476251 8:27870566-27870588 GAGATTCCCCCAAGGTGAGGTGG + Exonic
1039612376 8:38930084-38930106 TATTTTCCCCCCTGGGGAGCTGG + Intronic
1039945887 8:42128620-42128642 CCGTTTCCTCCACTGGGAGCTGG + Intergenic
1041674573 8:60525221-60525243 CAGTTTCCCCCATGCTGATCTGG + Intronic
1045834876 8:106508025-106508047 GAGATTGCCCCAGGGGGAGCAGG - Intronic
1047564704 8:126031244-126031266 CAGGTTGCCCCTAGGAGAGCTGG - Intergenic
1049263496 8:141652639-141652661 CAGGTGCCCCCATGAGGAGCAGG + Intergenic
1051356804 9:16246896-16246918 CTGGTTCCACCAAGGGGATCCGG - Intronic
1052677743 9:31648843-31648865 CAGTTTCCCCCAAAGGGACCAGG + Intergenic
1052718143 9:32143991-32144013 CAATTTCACCCAAGGATAGCAGG - Intergenic
1053159667 9:35805349-35805371 CAGTTTCCACCCAAGGAAGCAGG - Intronic
1053283927 9:36838577-36838599 CAGTTTCCCACAAGGGAAGTTGG + Exonic
1056850494 9:90079911-90079933 CACCTTCCCCAAAGGAGAGCTGG - Intergenic
1057080824 9:92173238-92173260 CCGCTGCCCCCAAGAGGAGCAGG + Intergenic
1057719868 9:97523370-97523392 CATTTCCCCCCAGAGGGAGCCGG - Intronic
1059283778 9:113155852-113155874 CAGTTTCCTCCGAGGGGAGCTGG - Intronic
1061227386 9:129288659-129288681 CAGGTTCCCCCAGGGAAAGCAGG - Intergenic
1061268234 9:129520909-129520931 TTTTTTTCCCCAAGGGGAGCTGG - Intergenic
1061892548 9:133630314-133630336 CAGTTTCCTCCATGGGCAGTAGG - Intergenic
1062352081 9:136144172-136144194 CAGTTTCCCCCTAGGTGCACTGG + Intergenic
1203747069 Un_GL000218v1:45677-45699 CAGTTTCCCCAGATGGCAGCAGG + Intergenic
1203563036 Un_KI270744v1:73803-73825 CAGTTTCCCCAGATGGCAGCAGG - Intergenic
1187023332 X:15407167-15407189 CAGTGGACTCCAAGGGGAGCAGG - Intronic
1187100499 X:16186486-16186508 CAGTTTCCCACAGTGGAAGCTGG - Intergenic
1190685853 X:52872494-52872516 CAGATTCCCAGAAGGGAAGCTGG - Intergenic
1191671420 X:63751997-63752019 TTTTTTCCCCCAAGGGGAGAAGG - Intronic
1197557535 X:127974988-127975010 CAGTTTCCTCCAATGGGCTCTGG - Intergenic
1197785163 X:130191177-130191199 CAGCTTCCCTCAAGGGGTGGGGG - Intergenic
1197952951 X:131917626-131917648 CAGTTTCACCCAGGAGGAGCAGG + Intergenic
1199792978 X:151172232-151172254 CCGTCTCCCCCAGGTGGAGCTGG - Intergenic
1201160390 Y:11160672-11160694 CAGTTTCCCCAGATGGCAGCAGG + Intergenic
1201286881 Y:12387005-12387027 CAGTTCCACCCCATGGGAGCAGG + Intergenic