ID: 1143940539

View in Genome Browser
Species Human (GRCh38)
Location 17:10536590-10536612
Sequence CTTCAGAGGGAGCTGGTGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 704
Summary {0: 1, 1: 0, 2: 7, 3: 55, 4: 641}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143940539_1143940546 11 Left 1143940539 17:10536590-10536612 CCCTCCACCAGCTCCCTCTGAAG 0: 1
1: 0
2: 7
3: 55
4: 641
Right 1143940546 17:10536624-10536646 AAAGAAATACTGTTTTGAATTGG 0: 1
1: 0
2: 4
3: 60
4: 578
1143940539_1143940547 15 Left 1143940539 17:10536590-10536612 CCCTCCACCAGCTCCCTCTGAAG 0: 1
1: 0
2: 7
3: 55
4: 641
Right 1143940547 17:10536628-10536650 AAATACTGTTTTGAATTGGCAGG 0: 1
1: 0
2: 0
3: 24
4: 369
1143940539_1143940548 16 Left 1143940539 17:10536590-10536612 CCCTCCACCAGCTCCCTCTGAAG 0: 1
1: 0
2: 7
3: 55
4: 641
Right 1143940548 17:10536629-10536651 AATACTGTTTTGAATTGGCAGGG 0: 1
1: 0
2: 0
3: 49
4: 851

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143940539 Original CRISPR CTTCAGAGGGAGCTGGTGGA GGG (reversed) Exonic
900268415 1:1773066-1773088 ACACAGAGGGAGCTGGTGAAGGG + Intronic
900415592 1:2533045-2533067 CTGCGGAGGGGGCTGGAGGAGGG + Intergenic
900502028 1:3010948-3010970 CATGGGAGGGACCTGGTGGAAGG - Intergenic
900714915 1:4138056-4138078 CTCCAGAAAGTGCTGGTGGAAGG - Intergenic
900809029 1:4787218-4787240 CTACAGTGGGAGGAGGTGGATGG + Exonic
900817467 1:4859455-4859477 CATAGGAGGGACCTGGTGGAAGG + Intergenic
901221671 1:7587031-7587053 CTTCTGGGGGAGCTGGTGGTGGG - Intronic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
901961318 1:12828583-12828605 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901967910 1:12883188-12883210 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901975714 1:12942318-12942340 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901983308 1:13053453-13053475 CCTCAGAGGGAGGCGGCGGAAGG + Intronic
901985702 1:13073878-13073900 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
901996107 1:13152889-13152911 CCTCAGAGGGAGGCGGCGGAAGG + Intergenic
901998780 1:13175465-13175487 CCTCAGAGGGAGGCGGCGGAAGG - Intergenic
902009460 1:13259447-13259469 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
902017266 1:13318592-13318614 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
902368300 1:15991076-15991098 CTTCAGAGGGCCCTGGAAGAGGG + Intergenic
902660912 1:17902958-17902980 CTAAAGAGGGAGCTGGTCCAGGG + Intergenic
902882619 1:19382743-19382765 GTTCTGCAGGAGCTGGTGGAAGG - Intronic
902962367 1:19973993-19974015 TTTCATAGGTAGCTGGTGGGAGG - Intergenic
903031836 1:20469222-20469244 CCTCAGAGGAGGCTGCTGGAGGG - Intergenic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
904814110 1:33182179-33182201 CTTCCCTGGGAGCTGGAGGATGG - Intergenic
905339371 1:37267745-37267767 ATTCAGGGGGAGCTGTTGGGTGG - Intergenic
905743645 1:40394191-40394213 CTTCTGAGGGAAATGGTAGATGG - Intronic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
907326899 1:53644165-53644187 CTGCAGTGGGAGCTGGTGATTGG - Intronic
907597848 1:55736074-55736096 CTAGGGAGGGACCTGGTGGAAGG - Intergenic
908266795 1:62387203-62387225 CTAGTGAGGGGGCTGGTGGATGG - Intergenic
908389943 1:63675267-63675289 CTGCTGAAGGAGCTGGGGGAGGG + Intergenic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
909974095 1:82025263-82025285 CTACAGAGAGACCTGGAGGAAGG - Intergenic
910661830 1:89681723-89681745 CATCGGAGGGACCTGGTGGGAGG - Intronic
910927498 1:92411782-92411804 CTTCAGTGTGTGCTGGTGGTGGG + Intergenic
911798908 1:102109499-102109521 CATGGGAGGGAGCTGGTGGTAGG - Intergenic
911990403 1:104689163-104689185 CATGAGAGGGACCTGGTGGGAGG - Intergenic
912430859 1:109627681-109627703 GATCAGAGGGAGCAGGTGGGAGG - Intronic
912498919 1:110108954-110108976 CTGCAGAGGGAGCAGGGGGATGG - Intergenic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
913596069 1:120378457-120378479 CATGGGAGGGACCTGGTGGAAGG - Intergenic
914091210 1:144500519-144500541 CATGGGAGGGACCTGGTGGAAGG + Intergenic
914307394 1:146433676-146433698 CATGGGAGGGACCTGGTGGAAGG - Intergenic
914373447 1:147051093-147051115 CTCCAGTGGGAGGTGTTGGATGG + Intergenic
914451722 1:147798582-147798604 CTCCTGAGGAAGCTGGGGGAGGG - Intergenic
914594713 1:149139455-149139477 CATGGGAGGGACCTGGTGGAAGG + Intergenic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
914999727 1:152578390-152578412 CTTCAGAGAGAGAAGGTGGAGGG - Intronic
915477071 1:156159425-156159447 TTTCAGCAGGAGCTGGTGGTTGG - Intronic
915592034 1:156876112-156876134 CTCAAGTGGGAGCTGGGGGAGGG + Exonic
915603686 1:156937962-156937984 TGTCAGAGAGAGCTGGAGGAAGG + Intronic
915759003 1:158292073-158292095 CTTCAAAGGGATCTGGAGGAAGG - Exonic
916828289 1:168464479-168464501 CATGAGAGGGACCTGGTGGGAGG - Intergenic
917221088 1:172729008-172729030 CATGGGAGGGACCTGGTGGAAGG - Intergenic
917304449 1:173612614-173612636 CATCAGAGGGAGACTGTGGAAGG - Intronic
918039360 1:180903294-180903316 CTTGGGAGGGACCTGGTGGGAGG - Intergenic
918221163 1:182437992-182438014 CTCCAGAGAGAGATGGTGTAGGG + Intergenic
919246039 1:194985261-194985283 TGTCAGAGGGACCTGGTGGGAGG + Intergenic
920535505 1:206734113-206734135 CCTCAGGGGCAGGTGGTGGAGGG + Exonic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
923525619 1:234770273-234770295 CTGCAGAGGGAGCTGGGAGCTGG + Intergenic
923719161 1:236452381-236452403 CTTAGGAGGGAGCTGGTGGGAGG + Intronic
924607122 1:245544453-245544475 TTCCAGAGGGAGGTGGTGGGTGG - Intronic
1062897835 10:1117929-1117951 CTTCAAACAGAGCTGGTTGAGGG - Intronic
1062928906 10:1339687-1339709 CTGCAGAGGGAGCGGGTGTGGGG + Intronic
1063022902 10:2147163-2147185 TGTGAGAGGGACCTGGTGGAAGG + Intergenic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1064543264 10:16426480-16426502 CATCGGAGGGACCTGGTGGGAGG - Intergenic
1064936434 10:20683731-20683753 CATGGGAGGGAACTGGTGGAAGG + Intergenic
1066277313 10:33881602-33881624 CATGAGAGGGACCTGGTGGGAGG - Intergenic
1066353416 10:34658721-34658743 CTTTAGAGGGAGCTGGAGCCTGG - Intronic
1066369649 10:34809627-34809649 CTGCAGAGGGAGTGGCTGGAAGG + Intronic
1066554461 10:36595890-36595912 TTTCAGAGGGAGCTTTTAGAAGG + Intergenic
1067173306 10:43925012-43925034 CTTCAGCGGGAGCAGCAGGAGGG - Intergenic
1067758591 10:49025889-49025911 CTTCAGAGAGAGCTGCAGAATGG - Intronic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1069646355 10:70001345-70001367 CTTGAGTGGGAGCTGAGGGAAGG - Intergenic
1069854906 10:71434739-71434761 CTTGAGGGGAAGGTGGTGGAGGG + Intronic
1070328514 10:75402727-75402749 ATTGAGAGGGAACTGGAGGAGGG + Intergenic
1070602256 10:77873979-77874001 CCTCAGTGTGAGCTGGAGGAGGG - Intronic
1070963436 10:80515285-80515307 CTTCAGAGGGCTGTGATGGAAGG + Intronic
1071022203 10:81070725-81070747 GTGGAGAGGGAGCTGATGGAAGG - Intergenic
1071673386 10:87632516-87632538 CATGGGAGGGAGCTGGTGGAAGG - Intergenic
1071893921 10:90043325-90043347 CATAAGAGGGACCTGGTGGAAGG + Intergenic
1072304773 10:94096577-94096599 CTTGGGAGGGACCTGGTGGGAGG - Intronic
1072502217 10:96028988-96029010 GTTCAGAGGGAGGTGGGGAATGG + Intronic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1073369467 10:102974147-102974169 CTTCAGATGGAGGTGTGGGAGGG + Intronic
1073462936 10:103676916-103676938 CTTCTGGGGGAGCTGGAGGGTGG - Intronic
1073573336 10:104599318-104599340 ATTCAGAGGGAGCAGGTGGAGGG + Intergenic
1073708566 10:106014660-106014682 CATGAGAGGGACCTGGTGGGAGG - Intergenic
1073897436 10:108179412-108179434 TTTCATAGGGAGGTGGGGGAAGG - Intergenic
1074558065 10:114510058-114510080 CATGGGAGGGACCTGGTGGAAGG - Intronic
1075015644 10:118908448-118908470 CTACAGTGGGGGCTGGGGGAGGG - Intergenic
1075052864 10:119195746-119195768 ATTCAGATGAATCTGGTGGAAGG + Intergenic
1076122252 10:127945508-127945530 CTTCAAAGGAAGCTGATGTATGG + Intronic
1076144734 10:128108491-128108513 CCTCAGAGGGACCTGGTGTCTGG + Exonic
1076219641 10:128722897-128722919 CTTCAAAGGGGACTGGTTGATGG + Intergenic
1076490817 10:130860136-130860158 CTTCAGAGGGTGCAGGAGGCTGG - Intergenic
1076698368 10:132257738-132257760 CTGCAGAGGGGCCTGGTGGAGGG - Intronic
1076773367 10:132679295-132679317 TTCCAGTGGGAGCTGGAGGAGGG + Intronic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1078857378 11:15217317-15217339 CATGAGAGGGACCTGGTGGGAGG - Intronic
1079828173 11:25225770-25225792 CATTAGAGGGACCTGGTGGGAGG - Intergenic
1080199567 11:29652837-29652859 CTCCTAAGGGAGCTTGTGGAGGG - Intergenic
1080238483 11:30099314-30099336 CATGAGAGGAAGCTGGTGGGAGG - Intergenic
1080404388 11:31965860-31965882 CTCCAGGGGGAGTTGGGGGAGGG + Intronic
1080573403 11:33577303-33577325 CTTCTGAGGCAGTTGCTGGAGGG + Intronic
1080871095 11:36237681-36237703 TTGCAGAAAGAGCTGGTGGAGGG + Intergenic
1081534825 11:43989046-43989068 CTTCACGGGGAGCTGGTCTAAGG + Intergenic
1084364716 11:68690144-68690166 GTTAAGGGGGAGGTGGTGGAGGG + Intronic
1084364733 11:68690227-68690249 GTTAACAGGGAGCTGGTGGTGGG + Intronic
1084477647 11:69398162-69398184 CTTGAGAGGGATCTTGAGGAGGG - Intergenic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1085857410 11:80190914-80190936 CATGAGAGGGACCTGGTGGGAGG + Intergenic
1086044965 11:82521854-82521876 CCTCTGAGGGGGCTGGTGTAGGG + Intergenic
1086809704 11:91293265-91293287 GGTAAGAGGAAGCTGGTGGAAGG - Intergenic
1087257617 11:95974161-95974183 GTTGAGAGGGACCTGGTGGGAGG + Intergenic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1088030722 11:105246138-105246160 CTCCACAGGCAGCTGGTAGAAGG - Intergenic
1088144083 11:106653088-106653110 CATGGGAGGGACCTGGTGGATGG + Intergenic
1088432466 11:109773915-109773937 CCTCAGAGGGAGAAGGAGGAAGG - Intergenic
1088605462 11:111526075-111526097 GGTCAGAAGGAGGTGGTGGAGGG + Intronic
1089450523 11:118592389-118592411 CTTCACAGGGAGCAGGTTCATGG - Intronic
1090187383 11:124747206-124747228 GTTCAGAGGGTGCCGGGGGAGGG + Exonic
1090596418 11:128325332-128325354 CTTCTGAGGGAGAAGGTAGATGG + Intergenic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1091727364 12:2855321-2855343 CTTCAGAGCCAGCTGGTGGTAGG + Intronic
1091776720 12:3189469-3189491 CTACAGAGGGAGAGGGTGCAGGG + Intronic
1092154486 12:6273640-6273662 CTTCAGTGGGAGCTGCTGACAGG + Intergenic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092657596 12:10703345-10703367 CTTCAAAGGGATCTTATGGAAGG + Intronic
1092795774 12:12109185-12109207 CATGAGAGGGACCTGGTGGGAGG - Intronic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1093195871 12:16129050-16129072 CATGGGAGGGACCTGGTGGAAGG + Intergenic
1093666174 12:21815882-21815904 CTTGAGAAGGATCTGGAGGATGG + Exonic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1094474878 12:30833334-30833356 CTTCAGCTGGAGGTGGAGGATGG - Intergenic
1095446415 12:42287187-42287209 CTGCAGTGGGAGGTGTTGGATGG + Intronic
1095521694 12:43074299-43074321 CTTTGGAGGGAGCTTTTGGAGGG - Intergenic
1096607501 12:52777166-52777188 GCTCTGGGGGAGCTGGTGGAGGG - Exonic
1096616304 12:52835138-52835160 CTTTGGAGGGAGCTGGAGGTGGG + Intergenic
1097744942 12:63291300-63291322 CATGGGAGGGAGCTGGTGGGAGG + Intergenic
1097812630 12:64035098-64035120 CTTAAGTGGGAGGTGGGGGATGG + Intronic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1098526313 12:71490958-71490980 CATGAGAGGGACCTGGTGGGAGG + Intronic
1098763421 12:74453823-74453845 CATGAGAGGGACCTGGTGGGAGG - Intergenic
1098944261 12:76573026-76573048 CTTGGGAGGGACCTGGTGGGAGG - Intergenic
1098994076 12:77097929-77097951 TGTGAGAGGGACCTGGTGGAAGG - Intergenic
1099838619 12:87938073-87938095 CATAAGAGGGACCTGGTGTAAGG + Intergenic
1099897111 12:88662018-88662040 CTTGGGAGGGACCTGGTGGGTGG - Intergenic
1100325222 12:93533817-93533839 CTGCAAAGGGGGATGGTGGATGG + Intergenic
1100674740 12:96855190-96855212 CATGAGAGGGACCTGGTGGGAGG - Intronic
1102042559 12:109810011-109810033 CTACAGAGGCAGATGGCGGAAGG + Intronic
1102990755 12:117314063-117314085 GCTCAGAGGGAGCCGCTGGAGGG - Intronic
1104613510 12:130249884-130249906 CTTAGGAGCGAGCTGGTGGTAGG - Intergenic
1104723617 12:131061055-131061077 CTGCAGTGGGGGCTGGGGGAGGG - Intronic
1104915219 12:132260883-132260905 CTTAGGAGGGGGATGGTGGAGGG + Intronic
1106404478 13:29461981-29462003 CTGCTGAGGGAGCTGGGAGAAGG + Intronic
1106578204 13:30995843-30995865 CCTCAGAGGGAGCTTCTGCATGG - Intergenic
1106841365 13:33688190-33688212 CTTCAGAGGGAGCTTTTTCAGGG - Intergenic
1107372371 13:39766707-39766729 CTTCTGTGGGAGCTTGGGGAGGG - Intronic
1107664494 13:42674895-42674917 CCTCAGTGAGAGCAGGTGGAAGG - Intergenic
1108474591 13:50801294-50801316 CTGCACTGGGAGCAGGTGGATGG - Intronic
1108705764 13:52984499-52984521 CATGGGAGGGAGCTGGTGGAAGG - Intergenic
1108906624 13:55483225-55483247 CATGGGAGGGACCTGGTGGAAGG + Intergenic
1109717511 13:66235206-66235228 CTAAGGAGGGACCTGGTGGAAGG + Intergenic
1109749713 13:66673158-66673180 CGTGGGAGGGACCTGGTGGACGG + Intronic
1109876880 13:68416724-68416746 CTTCTGAGGGCGATGGGGGAAGG + Intergenic
1110487387 13:76062494-76062516 TGTCAGAGGGACCTGGTGGGAGG - Intergenic
1110695620 13:78484733-78484755 CATGAGAGGGACCCGGTGGAGGG + Intergenic
1110931678 13:81226410-81226432 CTTCAGAAGGAGCAGATGGGAGG + Intergenic
1111627524 13:90808307-90808329 CATGAGAGGGAACTGGTGGGAGG - Intergenic
1111919785 13:94397876-94397898 CATGAGAGGGAACTGGTGGGAGG + Intronic
1112142964 13:96666269-96666291 CATCAGAGGGACCTGGTGGAAGG - Intronic
1112588922 13:100745983-100746005 CATGGGAGGGACCTGGTGGAAGG + Intergenic
1113386220 13:109850874-109850896 CTTGGGAGGGACCTGGTGGGAGG - Intergenic
1113735913 13:112679011-112679033 CATCAGAGGGAGACTGTGGAGGG + Intronic
1114195050 14:20469609-20469631 GCCCAGAGGGAGCTGGCGGAGGG + Intronic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1114557221 14:23568916-23568938 CACCAGAGGGGGCTGGAGGAGGG + Exonic
1114611793 14:24047595-24047617 CTTCTGGGGAAGCTGGGGGATGG - Intergenic
1114647256 14:24262727-24262749 CTGCAGAGCTAGCAGGTGGACGG - Intronic
1114954711 14:27803933-27803955 TGTCAGAGGGACCTGGTGGGAGG + Intergenic
1115403868 14:32994107-32994129 TTTCTGGGGGAGCTGGAGGAAGG + Intronic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1116014081 14:39385866-39385888 CTTGAAAGGGAGCTAGGGGACGG - Intronic
1116018419 14:39432869-39432891 GCTGAGAGGGAGCTGGCGGACGG + Intergenic
1116077558 14:40130692-40130714 GTTGAGAGAGACCTGGTGGAAGG + Intergenic
1116097104 14:40384344-40384366 CTTGGGAGGGACCTGGTGGGAGG - Intergenic
1116542114 14:46111750-46111772 CATGGGAGGGACCTGGTGGAAGG + Intergenic
1117961732 14:61170153-61170175 CTTCATAGGGAGCTGCGTGAGGG - Intergenic
1118080565 14:62354517-62354539 ATTCAGAGGGAACTGGTGTGAGG - Intergenic
1118668873 14:68101156-68101178 CATGAGAGGGACCTGGTGGGAGG - Intronic
1119541429 14:75440802-75440824 CTTCAGAGGGTACTTGTGCAGGG - Intronic
1119662908 14:76464317-76464339 CTTCAGAGGGCCCTGGGAGAGGG - Intronic
1121070240 14:91012830-91012852 CCTCAAAAGGAGCTGGAGGAAGG + Intronic
1121562908 14:94887670-94887692 GCTCAGTGGGAGCTGGGGGAGGG + Intergenic
1121776775 14:96596511-96596533 TGTGTGAGGGAGCTGGTGGAAGG - Intergenic
1121965874 14:98305199-98305221 CATAGGAGGGAGCTGGTGGGAGG + Intergenic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1122666463 14:103333885-103333907 CTTGAGGGGGAGATGGTGGTTGG - Intronic
1122770896 14:104097199-104097221 CTGTAGAGGGAGCTGGTGGGTGG + Intronic
1122918214 14:104868491-104868513 CTCCCGAGGGAGCCGGTGGCGGG - Exonic
1123995555 15:25715787-25715809 CTGCGGAGGGACCTGCTGGAAGG + Intronic
1124589103 15:31037193-31037215 CCTCAGAGAGGGCTGGAGGATGG + Intronic
1125534658 15:40436302-40436324 CTCCAGAGGGAGAGCGTGGAGGG - Intergenic
1125930470 15:43596086-43596108 CTTAAGAGGGTGCTGGTTGGTGG + Intronic
1125943638 15:43695918-43695940 CTTAAGAGGGTGCTGGTTGGTGG + Intronic
1126249145 15:46545954-46545976 CTTCAGGGGGAGCTAGTCAAAGG - Intergenic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1127497481 15:59526577-59526599 CTTGGGAGGGACCTGGTGGGAGG + Intergenic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1129608264 15:77035267-77035289 CTGCAGAGGGCGCCAGTGGAGGG + Intronic
1130210487 15:81917531-81917553 CTTGGGAGGGACCTGGTGGGAGG + Intergenic
1130561858 15:84965087-84965109 CATGGGAGGGACCTGGTGGAAGG + Intergenic
1133273688 16:4624464-4624486 TTTCAGAGGGGGCAAGTGGAAGG + Intronic
1133338352 16:5021005-5021027 CTGCAGTGGGAGCTGGGGTAGGG + Intergenic
1133345073 16:5064481-5064503 CTTCAGCTGCAGCTGGTGGATGG - Intronic
1133523262 16:6579437-6579459 CATGGGAGGGACCTGGTGGAAGG + Intronic
1134169767 16:11958982-11959004 CTGCAGGGGGAGCTCGTAGAGGG + Intronic
1134327714 16:13222190-13222212 CTTGGGAGGGACCTGGTGGGAGG - Intronic
1134600596 16:15530665-15530687 CATGAGAGGGACCCGGTGGAAGG + Intronic
1135117877 16:19738993-19739015 CTGCAGAGGGAGCATGGGGAGGG - Intronic
1135464335 16:22672325-22672347 GTGCAGAGAGAGCTGGTGGTAGG - Intergenic
1135529339 16:23239196-23239218 CGTGGGAGGGAGCTGGTGGGAGG - Intergenic
1135881528 16:26262440-26262462 CGTAAGAGGGACCTGGTGGGAGG + Intergenic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1137308998 16:47234825-47234847 CATGGGAGGGACCTGGTGGAAGG + Intronic
1137631753 16:49951391-49951413 ATTCAGAGGAAGCTGGATGAAGG + Intergenic
1137883111 16:52073281-52073303 CTTCTCAGGGAGCAGGAGGAGGG + Intronic
1137947911 16:52751860-52751882 AAGCAGAGGGAGCTGGTGGGTGG - Intergenic
1138168538 16:54826730-54826752 CCTCAGAGGGAGGTTGTGGATGG - Intergenic
1138423565 16:56915518-56915540 CTCCTGAGGGACCTGGAGGATGG + Exonic
1138518595 16:57555836-57555858 TTGGAGAGGGACCTGGTGGAAGG + Intronic
1139029221 16:62859153-62859175 CATGGGAGGGACCTGGTGGAAGG + Intergenic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1139960132 16:70712706-70712728 CTTCTGAGGGAGGAGGTGGCAGG + Intronic
1140323169 16:73973675-73973697 CGACAGAGGGAGGTGATGGATGG + Intergenic
1141836303 16:86542037-86542059 CTTCTGAGGGAGCAGGGGGTGGG - Intronic
1142286342 16:89173062-89173084 CCTCAGGGGCAGCTGCTGGAGGG - Intronic
1142291814 16:89196530-89196552 CTCCAGAGTGAGCAGGGGGAAGG + Intronic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1143309913 17:5979531-5979553 CTTCAGAGGGCGCTGGACCACGG + Intronic
1143686595 17:8522384-8522406 CTTCAGTGGAAGCTGGGAGAAGG + Intronic
1143940539 17:10536590-10536612 CTTCAGAGGGAGCTGGTGGAGGG - Exonic
1144093594 17:11880226-11880248 CTTCGGGGGGAGCTGGTTCATGG + Intronic
1145277347 17:21440514-21440536 CTTCAGGGACAGCTGGTGGTAGG + Intergenic
1145315185 17:21726409-21726431 CTTCAGGGACAGCTGGTGGTAGG + Intergenic
1145713616 17:26998345-26998367 CTTCAGGGACAGCTGGTGGTAGG + Intergenic
1145761111 17:27425884-27425906 CTTCAGAGGGCCCTGGAAGAGGG + Intergenic
1146161159 17:30560042-30560064 CTTCAGAGGGCCCTGGAAGAGGG + Intronic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146265799 17:31451791-31451813 CTTGAGAGGGTGGTGGGGGAAGG - Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1146460142 17:33039724-33039746 TGTCAGAGGGAGTTGGAGGAGGG + Intronic
1146714633 17:35074837-35074859 CTTCAGTGGGAGTTAGGGGAAGG - Intronic
1148367687 17:47069032-47069054 GTTGAGGGGCAGCTGGTGGAAGG - Intergenic
1148838060 17:50476826-50476848 CTGCTGAGGCAGCTGGGGGATGG + Intergenic
1149850869 17:60032872-60032894 CTCCTGAGGGACCTGGAGGACGG + Intergenic
1149859297 17:60113652-60113674 CTCCTGAGGGACCTGGAGGACGG - Intergenic
1150265267 17:63828132-63828154 CTTCAGATGGAGCTGGAGGAGGG + Exonic
1150637930 17:66929231-66929253 CTCGAGAGGGACCTGGTGGGAGG + Intergenic
1150830759 17:68517616-68517638 CCTGAGAGGGACCTGGTGGGAGG - Intronic
1151369334 17:73638005-73638027 CATCTGCGGGAGCTGCTGGAGGG + Intronic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152126432 17:78450100-78450122 CTGCAGATGGAGCTGGAAGAGGG - Intronic
1152554045 17:81044241-81044263 CTTCACAGGGAGGGGATGGATGG + Intronic
1152793837 17:82296975-82296997 CTTCATGGGGCGCTGGGGGAAGG - Intergenic
1152926027 17:83088167-83088189 CTGCAGAGGCGGCTGGTGCAGGG - Intronic
1152937242 17:83146599-83146621 CATGGGAGGGACCTGGTGGAAGG - Intergenic
1153007805 18:512993-513015 CTTGAGAGGGAGACCGTGGAAGG + Intergenic
1153466649 18:5395555-5395577 CTTGAGAGCGAGCTGGAGGAAGG - Intronic
1153650124 18:7231973-7231995 CCTCTGCCGGAGCTGGTGGAGGG + Exonic
1153988552 18:10374830-10374852 ATTCAGATGGCGCTGGTGGCAGG + Intergenic
1154427996 18:14286841-14286863 CTTCAGAGGGAGCAAGTTGCAGG + Intergenic
1156095944 18:33531684-33531706 TGTCAGAGGGGGCTGGGGGAGGG + Intergenic
1156269050 18:35514332-35514354 CATCAAAGGGAGATGGAGGATGG - Intergenic
1157110839 18:44818825-44818847 TCACAGAGGGAGATGGTGGAAGG - Intronic
1157746593 18:50141493-50141515 ATTCAAGGGGAGCTGGTGGTAGG - Intronic
1158413926 18:57232613-57232635 CTTTACAGGGAGCTGTTAGAAGG + Intergenic
1158536888 18:58316259-58316281 AAAGAGAGGGAGCTGGTGGATGG - Intronic
1158739198 18:60120364-60120386 CATTAGAGGGAGATGGGGGATGG - Intergenic
1159338117 18:67097856-67097878 CTTGGGAGGGACCTGGTGGGAGG + Intergenic
1159379343 18:67636716-67636738 ATTTAGAGGGAGCTGGCAGATGG + Intergenic
1159634665 18:70790091-70790113 CATGAGAGGGAGCTGGTGGAAGG - Intergenic
1159651846 18:70987099-70987121 CAAGGGAGGGAGCTGGTGGAAGG + Intergenic
1159887150 18:73919706-73919728 CCCCAGTGGGAGCTGCTGGAAGG + Intergenic
1159895849 18:73995448-73995470 CATCAGAGGGACCTAGTGGGAGG + Intergenic
1160627057 18:80218025-80218047 CATGAGAGGGATCTGGTGGGAGG - Intronic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1163279268 19:16305468-16305490 CATCAGAGGAAGCTGGTGGAAGG + Intergenic
1163435540 19:17292973-17292995 CTCAAGGGGGAGCTGGAGGATGG + Intronic
1163786170 19:19275966-19275988 CTGCAGAGGGAGGTTGGGGAGGG - Intergenic
1164419398 19:28075547-28075569 CTTGGGAGGGACCTGGTGGGAGG - Intergenic
1164575386 19:29402657-29402679 CTTCTGAGGGGTCTGCTGGAGGG - Intergenic
1165147253 19:33738931-33738953 CTAGAGAGGGAGATGGTGGGTGG + Intronic
1165949256 19:39464775-39464797 CTGCAGGGTGAGCCGGTGGAAGG - Intronic
1166042617 19:40212945-40212967 CTGCAGAAGGAGCGGGTGGGAGG + Exonic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1166599537 19:44081835-44081857 CATAAGAGGGAGCTGGTGGGAGG - Intronic
1167374337 19:49103066-49103088 CTGCAGACGCAGCTGGTGGGAGG + Intronic
1167448924 19:49556035-49556057 CTTGGGAGGGAGCGTGTGGAGGG + Intronic
1167510506 19:49893270-49893292 CTTGAGAGGAGGCTGGGGGAGGG + Intronic
1167563364 19:50239995-50240017 CTTGAGGGGGTGCTGGTGGTGGG - Intronic
1167715145 19:51138210-51138232 GTGCAGAGGGAGCTGCTGGACGG + Intergenic
1167924342 19:52810913-52810935 CATCAGAGGGAGACTGTGGAGGG - Intronic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
1168301170 19:55406015-55406037 TTGTAGAGGAAGCTGGTGGAAGG - Intronic
1168692630 19:58386176-58386198 GTTCAGAGGCAGCTGGGGGAAGG + Intergenic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
925644709 2:6023940-6023962 CACCAGAGGGAGAAGGTGGAAGG + Intergenic
926722476 2:15971460-15971482 CTGCAGAGGGGGCTGGTGGGGGG + Intergenic
927097676 2:19759990-19760012 CTGCAGAGGAAGCTGGTGTATGG - Intergenic
927274488 2:21250960-21250982 CTGGAGAGTGAGCTGGAGGAAGG + Intergenic
927576876 2:24207818-24207840 CTGCAAAGGGAGAGGGTGGATGG + Intronic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928046968 2:27944387-27944409 GTTAAGAGGAAGGTGGTGGAGGG - Intronic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
928609788 2:32981688-32981710 CATGAGAGGGACCTGGTGGAAGG + Intronic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
929770888 2:44891281-44891303 CATGGGAGGGACCTGGTGGAAGG - Intergenic
930341671 2:50123831-50123853 CTTCAGATGGATATTGTGGAAGG + Intronic
930887781 2:56347700-56347722 GTTCAGAGTGAACTGGAGGAGGG + Intronic
931979885 2:67683353-67683375 CTTGAGAGGCAACTGGTGGGCGG - Intergenic
932440223 2:71730162-71730184 TGTGAGAGGGACCTGGTGGAAGG - Intergenic
932820577 2:74896252-74896274 CTTCAGAGGGTGGAGGGGGAAGG + Intergenic
932846872 2:75144188-75144210 GTTCAGTGGGAGCTGATCGATGG + Intronic
934482604 2:94665347-94665369 TGTCAGAGGGACCTGGTGGGAGG - Intergenic
935372732 2:102364957-102364979 CATAGGAGGGACCTGGTGGAAGG - Intronic
935542639 2:104367714-104367736 GGGCAGAGGGAGCTGGAGGAAGG + Intergenic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
935800693 2:106692305-106692327 CTGCAGAAGGGGCAGGTGGAGGG + Intergenic
936409084 2:112238094-112238116 TTGTAGAGGGAGCTGGAGGATGG - Intronic
937126839 2:119480452-119480474 CATGGGAGGGACCTGGTGGAAGG - Intronic
937875636 2:126823336-126823358 ATTCAGAGGAAGCTGGCAGAAGG - Intergenic
938092853 2:128444599-128444621 GCTCAGAGGGAGGTGGTGCAAGG + Intergenic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
938656419 2:133439115-133439137 ATTCAGAGTGAGCTGCTGAAAGG + Intronic
940161176 2:150715159-150715181 CATCAGAGGGACCTGGTAGAAGG - Intergenic
940413164 2:153389723-153389745 CTACAGTGGCACCTGGTGGAGGG + Intergenic
940505467 2:154547462-154547484 CATGAGAGGGACCTGGTGGGAGG + Intergenic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
941115426 2:161466822-161466844 CTTCAGATAGAGCTGGAGAAAGG - Intronic
942513569 2:176728266-176728288 CTGCAGATGGAGCTGGTCCACGG - Intergenic
942750425 2:179280288-179280310 CTTGGGAGGGACCTGGTGGGAGG - Intergenic
943237517 2:185341130-185341152 CAAGAGAGGGATCTGGTGGAAGG - Intergenic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
944143259 2:196479690-196479712 CTGGAGAGGTTGCTGGTGGAGGG - Intronic
944659165 2:201906312-201906334 CTTCAGTGTGAGCTGCTGAAAGG + Intergenic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945432032 2:209775927-209775949 CTTCAGAGAGAGCTGGAGAGAGG - Exonic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
946088604 2:217199091-217199113 GTACAGAGGCAGCTGGTGGTGGG - Intergenic
946122958 2:217532456-217532478 CATGGGAGGGACCTGGTGGAAGG + Intronic
946640920 2:221782708-221782730 CATGGGAGGGACCTGGTGGAAGG + Intergenic
946824965 2:223668374-223668396 CATGAGAGGGACCTGGTGGGAGG - Intergenic
947668249 2:231920450-231920472 CTTGAGAGGTTGCTGCTGGAGGG + Intergenic
947868742 2:233420192-233420214 CTGCTGAGGGAACTGGGGGAGGG - Intronic
948017894 2:234704963-234704985 CTGCAGAGGGGGCAGGGGGAAGG + Intergenic
948450435 2:238067018-238067040 CATCAGAGGGACCCGGTGGGAGG - Intronic
948823733 2:240564296-240564318 CCTCAGAGGGCACTGGTGGCAGG - Intronic
1168872958 20:1146588-1146610 CTTCAGAGCGATATGGAGGAGGG - Intronic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1169321267 20:4635083-4635105 TTTCAGAGGGAGCAGGTGCAGGG - Intergenic
1170530655 20:17287923-17287945 TTTCAGGGTGAGCTGGGGGAGGG - Intronic
1171059321 20:21940780-21940802 CCTCATGGGGAGCTGGGGGAAGG + Intergenic
1172606397 20:36217058-36217080 CTTCAGAGGCATCAGCTGGAGGG - Intronic
1172719504 20:36988753-36988775 TTACAGAGGGGCCTGGTGGAAGG + Intergenic
1172838475 20:37887904-37887926 CGTGAGGGGGAGCTGGTGGGAGG + Intergenic
1173047817 20:39529394-39529416 GGTGAGAGGGAGCTGCTGGAGGG + Intergenic
1173224306 20:41152993-41153015 CTGCAGAGGGCACTGGAGGAAGG - Intronic
1173809628 20:45948095-45948117 CATGAGAAGGAGCTGCTGGAGGG - Intergenic
1174282089 20:49446870-49446892 CTTCAGAGGGAGATGAGGGATGG - Intronic
1174891953 20:54404826-54404848 CATGAGAGGGACCTGGTGGGAGG + Intergenic
1174965614 20:55211182-55211204 CTTAAGAGGGGGAGGGTGGAAGG + Intergenic
1175155496 20:56968319-56968341 CTTCATAGGGGGCTGGAGGGAGG - Intergenic
1175215490 20:57390015-57390037 CTAGAGCGGGAGCTGGGGGAGGG + Intergenic
1175487579 20:59356483-59356505 CTTCTGAAGGATCTGCTGGAGGG - Intergenic
1177656324 21:24021095-24021117 CATGGGAGGGACCTGGTGGAAGG + Intergenic
1177699089 21:24613842-24613864 TTTGAGAGGGACCTGGTGGGAGG + Intergenic
1177931392 21:27288466-27288488 CTTAGGAGGGACCTGGTGGGAGG - Intergenic
1177995306 21:28089687-28089709 CTTCTGGTGGAGGTGGTGGAGGG + Intergenic
1178370553 21:32023569-32023591 AGTCAGAGGGAGCTGGGGGAGGG - Intronic
1179167735 21:38947784-38947806 TTGCAGAGGGAGCTTGTTGAGGG - Intergenic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1182063929 22:27417135-27417157 TTTGAGAGGGTGCTGGTGGTTGG - Intergenic
1182320262 22:29474238-29474260 CCACAGAGTGAGGTGGTGGAGGG - Intergenic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1182660065 22:31918884-31918906 CTGCAGGGGCAGCTGCTGGAAGG - Intergenic
1182823198 22:33237075-33237097 CTCCAGAGGGATATAGTGGAAGG - Intronic
1182947256 22:34334825-34334847 GTCCAAAGGGAGCTGGTGGATGG + Intergenic
1182951894 22:34383884-34383906 CATCAGAGGGAACTGGTGGGAGG + Intergenic
1183343258 22:37293739-37293761 CTTCAGGGGGTGCTGGTGGTTGG + Intronic
1183371732 22:37436371-37436393 CTTCAGGGGAAGCTGGGTGAAGG - Intergenic
1183653551 22:39172262-39172284 CTGCAGTGGGAGATGGTGGATGG + Intergenic
1183653564 22:39172317-39172339 CTGCAGTGGGAGATGGTGGGTGG + Intergenic
1183653577 22:39172372-39172394 CTGCAGTGGGAGATGGTGGGTGG + Intergenic
1183717941 22:39545166-39545188 CTGGAGAGGGAGCTTCTGGAAGG - Intergenic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184386298 22:44177000-44177022 CATGAGAGGGACCTGGTGGGAGG - Intronic
1184764078 22:46562428-46562450 CTTCATGGGGAGGTGGAGGAAGG + Intergenic
1185101205 22:48841811-48841833 CTGCAGATGGAGCTGGGGGATGG + Intronic
1185168381 22:49276489-49276511 CTTCAGCTGGGGCTGGGGGATGG - Intergenic
1185345796 22:50310019-50310041 TTGCAGAGGGCCCTGGTGGAGGG + Exonic
950107246 3:10396130-10396152 CCACAGTGGGAGCTGTTGGAGGG + Intronic
950539852 3:13605321-13605343 ATGCAGATGGAGGTGGTGGATGG - Intronic
950715062 3:14842135-14842157 CCTCAGAGGGAAATGGTAGAAGG - Intronic
951068867 3:18301895-18301917 CATGAGAGGGAGCTGGTGGGAGG + Intronic
951177248 3:19616175-19616197 CATGGGAGGGAGCTGGTGGGAGG - Intergenic
952631379 3:35472422-35472444 CTTGGGAGGGACCTGGTGGGAGG - Intergenic
952733827 3:36668016-36668038 CATGGGAGGGACCTGGTGGAAGG - Intergenic
952891666 3:38046333-38046355 CATGGGAGGGACCTGGTGGAAGG + Intronic
953274412 3:41480943-41480965 CATGGGAGGGACCTGGTGGAAGG - Intronic
953634650 3:44652513-44652535 TTTAAGAGGGAACTGGTGGTAGG - Intronic
953666101 3:44927714-44927736 CTTCAGATGGAGCTGGTCAAAGG + Intronic
953877430 3:46674248-46674270 GCTCTGAGGGAGCTGTTGGAAGG + Intronic
954389079 3:50259600-50259622 CTTCTAAGGGAGCTGTTGTAAGG + Intergenic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
954442379 3:50528756-50528778 CCTGAAAGAGAGCTGGTGGAGGG - Intergenic
954642350 3:52108678-52108700 GTTCTGAGGGCTCTGGTGGAGGG - Intronic
954808309 3:53232789-53232811 CTTCAGCTGGAGCAGGTGGCCGG + Intronic
954965879 3:54610487-54610509 ATTCAGTGGGAGCTGGGTGATGG + Intronic
955467452 3:59252050-59252072 CTTCATAAGGAGCTGGTCCAAGG - Intergenic
956102689 3:65784940-65784962 CTTGAGAGGGTGGCGGTGGAGGG + Intronic
956568968 3:70672736-70672758 CTTGAGAGAGAGCTTTTGGAAGG + Intergenic
956815470 3:72904296-72904318 CATCAGTAGGAGCTGGTGAAAGG + Intronic
956946953 3:74234257-74234279 CATGAGAGGGACCTGGTGGGAGG - Intergenic
956948136 3:74247942-74247964 CTTCAGAGGGACCCAGTGGGAGG - Intergenic
957094727 3:75768174-75768196 CTTTAGATGGGGTTGGTGGAAGG - Intronic
957958714 3:87222890-87222912 TGTGAGAGGGAGCTGGTGGGAGG + Intergenic
958707853 3:97678366-97678388 GTTCAGAGGGTGCAGTTGGAAGG + Intronic
958857022 3:99398011-99398033 CATGGGAGGGACCTGGTGGAAGG - Intergenic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
960067027 3:113384985-113385007 CATGGGAGGGACCTGGTGGAAGG + Intronic
960157353 3:114309352-114309374 CCTCTGAGAGAGATGGTGGAAGG - Exonic
960158066 3:114318191-114318213 CTTCACAGTGAGCAGATGGATGG + Intergenic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
961141865 3:124562820-124562842 CTTTGGAGGGTGGTGGTGGAGGG - Intronic
961173779 3:124817564-124817586 CCTCAGTGGGAGAGGGTGGAAGG + Intronic
961313076 3:126016197-126016219 CTTGAGAGGGAGCTGGAGGGTGG + Intronic
961505730 3:127369563-127369585 CTGCAGAGGGAGGTGGTGGGAGG - Intergenic
962067132 3:131992749-131992771 TGTCAGAGGGACCTGGTGGGAGG + Intronic
962366805 3:134792232-134792254 CGTAAGCGGGACCTGGTGGAAGG - Intronic
962821846 3:139055771-139055793 CTCCAGAGGAATCTGGTTGAGGG + Intronic
962951833 3:140226942-140226964 CATGAGAGGGACCTGGTGGGAGG - Intronic
963418476 3:145028439-145028461 TGTGAAAGGGAGCTGGTGGAAGG + Intergenic
963498217 3:146095910-146095932 CATCAGAGGGAGACTGTGGAGGG - Intronic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
965101825 3:164308855-164308877 CATGAGAGGGACCTGGTGGGAGG - Intergenic
965270593 3:166613079-166613101 CATGAGAGGGACCTGGTGGGAGG - Intergenic
966115824 3:176459076-176459098 TTTGGGAGGGACCTGGTGGAAGG + Intergenic
966387050 3:179409939-179409961 GTTGTGAGGGAGCCGGTGGAAGG + Intronic
966682827 3:182661480-182661502 TTTCACAGGGAAGTGGTGGAAGG + Intergenic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
967426550 3:189333794-189333816 GTTCTGAGGGAGTTGGTGGTGGG + Intergenic
968262546 3:197336799-197336821 CTTCCTAGTCAGCTGGTGGAGGG + Intergenic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
968657886 4:1786491-1786513 CTTCTGTGGGAGCAGGTGGCAGG + Intergenic
968811051 4:2799811-2799833 CTTGAGGGGGAGCAGGAGGAGGG + Intronic
969497527 4:7534638-7534660 CTGCAGGGGGAGCTGGGAGATGG + Intronic
969672885 4:8599324-8599346 CATGAGATGGAGCTGGCGGAGGG + Intronic
970069397 4:12139823-12139845 CTTCACAATGAACTGGTGGATGG + Intergenic
970180147 4:13383647-13383669 CATGGGAGGGACCTGGTGGAAGG + Intronic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
970411173 4:15809245-15809267 CAGCTGAGGGAGGTGGTGGAGGG + Intronic
970523648 4:16910379-16910401 CTCCACTGGGAGCTAGTGGAAGG + Intergenic
970742562 4:19255187-19255209 CATGAGAGGGACCTGGTGGGAGG + Intergenic
971555597 4:28010872-28010894 GTCCAAAGGGAGCTGGTGGACGG + Intergenic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
972871998 4:43311936-43311958 CTTGGGAGGGACCTGGTGGAAGG + Intergenic
972896075 4:43621397-43621419 CAATAGAGGGACCTGGTGGAAGG - Intergenic
972998821 4:44919140-44919162 CATGAGAGGGACCTGGTGGGAGG + Intergenic
973069883 4:45845058-45845080 CTTGGGAGGGACCTGGTGGGAGG + Intergenic
973601695 4:52548869-52548891 CTTGGGAGGGACCTGGTGGGAGG - Intergenic
973810270 4:54562582-54562604 AATCAGAGGGAGCTGGGAGATGG + Intergenic
974081683 4:57220398-57220420 CTGCTATGGGAGCTGGTGGAGGG - Intergenic
974081810 4:57221710-57221732 CTGCTATGGGAGCTGGTGGAGGG + Intergenic
974144973 4:57936075-57936097 TGTGAGAGGGACCTGGTGGAAGG + Intergenic
974779643 4:66537298-66537320 CTTCAGAAGGAGTTTGTGTATGG + Intergenic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
976442396 4:85089967-85089989 CGTGGGAGGGACCTGGTGGAAGG + Intergenic
977129621 4:93218981-93219003 CATAAGAGGGACCTGGTGGGAGG - Intronic
978310234 4:107379270-107379292 CATCAGAGGCAGGTGGTGTAGGG + Intergenic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
980093309 4:128464555-128464577 CTCCAGGGGGAACTGGAGGAGGG - Intergenic
981236550 4:142422703-142422725 CTTGGGAGGCTGCTGGTGGAAGG + Intronic
981242251 4:142492000-142492022 CTTGGGAGGGACCTGGTGGGAGG + Intronic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
983138723 4:164121576-164121598 CATGGGAGGGAGCTGGTGGGAGG - Intronic
983511900 4:168617880-168617902 GTTCTGGGGTAGCTGGTGGAGGG - Intronic
983714060 4:170755329-170755351 CATGAGAGGGACCTGGTGGGAGG + Intergenic
984286440 4:177735699-177735721 CATGAGAGGGACCTGGTGGGAGG + Intronic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
985420418 4:189779824-189779846 ATTGAGAGGGAGCTGGTGTCTGG + Intergenic
985900009 5:2780795-2780817 GAGCAGAGGGAGCTGGTGGGTGG - Intergenic
985928526 5:3036148-3036170 ACTGAGTGGGAGCTGGTGGATGG + Intergenic
986122831 5:4857784-4857806 CATCAGAGGGTGCTGGGAGATGG - Intergenic
986405760 5:7423404-7423426 CTTGGGAGGGACCTGGTGGGAGG + Intronic
986482329 5:8202171-8202193 CTTCAGGGGGAGCTCCGGGAAGG + Intergenic
987806872 5:22780630-22780652 CGTGAGAGGGACCTGGTGGGAGG - Intronic
987975561 5:25010887-25010909 CGTGGGAGGGACCTGGTGGAAGG - Intergenic
988500986 5:31783610-31783632 CTTCAGTGGAACCTGGTGGGTGG + Intronic
988996483 5:36719895-36719917 ATTCAGATGCAGCTGGTTGAAGG - Intergenic
989471957 5:41830283-41830305 CTTCAGAAAGGGTTGGTGGAAGG + Intronic
989545342 5:42665981-42666003 CATGAGAGGGAGCTGGTGGAAGG - Intronic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
990669312 5:58109671-58109693 CTTGAAAGGGAACTGGTGAAAGG + Intergenic
990684481 5:58286000-58286022 CTAGAGAGGGACCTGGTGGAAGG - Intergenic
991006831 5:61836167-61836189 CTCAAGAGAGAGATGGTGGAAGG + Intergenic
991020933 5:61979738-61979760 ATTCAGGGGGAGCTGGGGGAAGG - Intergenic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
991399021 5:66234526-66234548 CTTGAGCGGGAGCTCATGGAAGG + Intergenic
991405159 5:66294159-66294181 CTTGAGCGGGAGCCCGTGGAAGG - Intergenic
991457960 5:66824453-66824475 GTTCAGCGAGAGCTGCTGGATGG + Intronic
991559238 5:67931729-67931751 CTTGAGAGAGATCTGGTGGGAGG - Intergenic
992189783 5:74280481-74280503 CTCTAGAGGGTGCTGGTGGTTGG - Intergenic
992579462 5:78157066-78157088 CTTCAGCAGGAGATGGTGGGGGG + Intronic
992974309 5:82097845-82097867 CTTCAGAGGGATCTGGAATATGG + Intronic
993823747 5:92654835-92654857 CTTGAGAGGGACCTGGTGGGAGG - Intergenic
995310011 5:110699778-110699800 CCTCAGAGGGTGGTGGAGGAGGG - Intronic
995389613 5:111626066-111626088 CATCAGAGGGACCTGGTGGGAGG + Intergenic
996042163 5:118827413-118827435 CATGAGAGGGACCTGGTGGGAGG - Intergenic
996922682 5:128787360-128787382 CATGAGAGGGAACTGGTGGGAGG - Intronic
998385498 5:141754913-141754935 ATCCAGAGGGAGCTGCTAGAGGG - Intergenic
998756464 5:145386297-145386319 CATGGGAGGGACCTGGTGGAAGG - Intergenic
999561059 5:152803433-152803455 CCTGAGAGGGACCTGGTGGGAGG - Intergenic
1000329487 5:160195836-160195858 CCCCAGAGGGAGCTGCTGCATGG + Intronic
1000346228 5:160316328-160316350 CTTCAGAGGTTGAGGGTGGAGGG - Intronic
1000614888 5:163415769-163415791 CTGCAGAGGCAGGAGGTGGAGGG + Intergenic
1001642279 5:173252910-173252932 CTAGGGAGGGACCTGGTGGAAGG - Intergenic
1002178130 5:177414070-177414092 CCTAAGAAGGAGCTAGTGGAAGG - Intronic
1002360630 5:178667875-178667897 CCAGAGAGGGAGCTGGTGGAAGG + Intergenic
1003138842 6:3455608-3455630 CTCCAGAGGGGGCTGGTGACAGG + Intronic
1003152836 6:3567054-3567076 CTACAGAGAGAGATGGTGGCTGG - Intergenic
1003380527 6:5620790-5620812 GATCAGAGGCAGTTGGTGGATGG + Intronic
1003607773 6:7580317-7580339 CTGCATGGTGAGCTGGTGGATGG - Exonic
1003640267 6:7869973-7869995 GTTCTGAGGGTGGTGGTGGAGGG - Intronic
1005266215 6:24114718-24114740 CTTCACAGGGAGCTGGTCACAGG + Intergenic
1005740328 6:28785396-28785418 CTTCTGGGGGAGGGGGTGGAGGG - Intergenic
1005982800 6:30850287-30850309 CATGAGAGGGACCTGGTGGGAGG + Intergenic
1006155510 6:32011011-32011033 CCTCAGAGTGTGCAGGTGGACGG - Intergenic
1006161843 6:32043865-32043887 CCTCAGAGTGTGCAGGTGGATGG - Exonic
1006335875 6:33420324-33420346 CTTCAGAGGTACGTGGTGGGGGG + Exonic
1006339963 6:33441507-33441529 CCTCTGAGGGTGCAGGTGGAGGG - Intronic
1006368921 6:33632684-33632706 CAGCAGAGGGAGCAGGAGGATGG - Intronic
1006388683 6:33746398-33746420 CTACAGAGGAAGCTGGGGGGAGG - Intronic
1006399668 6:33809863-33809885 CTCCAGAGTGGGCTGGTTGAAGG - Intergenic
1006679544 6:35787267-35787289 CTTCTGGGGGAGCCTGTGGACGG + Intronic
1007321796 6:41033147-41033169 CTGCAGAGGGAGCCAGTGGCAGG + Intronic
1007697868 6:43744948-43744970 CATGAAAGGGAGCTGGAGGAGGG + Intergenic
1007866343 6:44973918-44973940 CGTGGGAGGGACCTGGTGGAAGG - Intronic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1008919850 6:56831474-56831496 TTTCAGTGGGAGCTGGGGAAGGG - Intronic
1010155086 6:72783181-72783203 CTGTAGAGAGAGATGGTGGAGGG + Intronic
1011166463 6:84452954-84452976 TATGAGAGGTAGCTGGTGGAGGG - Intergenic
1011644726 6:89446767-89446789 CGTGGGAGGGACCTGGTGGAAGG + Intronic
1012202687 6:96425281-96425303 CTTAGGAGGGACCTGGTGGGAGG - Intergenic
1012832941 6:104228637-104228659 CATGGGAGGGAGCTGGTGGGAGG + Intergenic
1012896311 6:104953657-104953679 CTGCAGAGGCAGGAGGTGGAGGG + Intergenic
1013715934 6:112961635-112961657 GGTCAGAGGGACCTGGTGGAAGG + Intergenic
1014532774 6:122578790-122578812 CGTGGGAGGGACCTGGTGGAAGG + Intronic
1015852879 6:137592833-137592855 CATGAGAGGGACCTGGTGGGAGG - Intergenic
1016037168 6:139395414-139395436 CTCCAGAGGGAGTTGGGGGCTGG + Intergenic
1016786556 6:148016852-148016874 CATGAGAGGGACCTGGTGGGAGG - Intergenic
1017179153 6:151533710-151533732 CTTCAGATGAAGGAGGTGGAAGG - Intronic
1018073754 6:160191206-160191228 CTTCACAGGGAGTGGGTGGGAGG - Intronic
1018447850 6:163874655-163874677 CATGGGAGGGAGCTGGTGGGAGG - Intergenic
1018705060 6:166458005-166458027 CTACAGAAGGAGCTTGTGGATGG + Intronic
1019352917 7:563329-563351 CTGCAGAGGCAGCCTGTGGAGGG - Intronic
1019455325 7:1123815-1123837 CTTCCGAGGGAGCTGGCGGAGGG - Intronic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019614997 7:1955243-1955265 CTCCAGAGGGAGCGGGAGCAGGG + Intronic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1020125608 7:5531060-5531082 CTGCAGAAGGAGCTCTTGGAGGG + Intronic
1021142283 7:17041672-17041694 CTTCAGAGGGATCTACTGAATGG + Intergenic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1022257070 7:28669522-28669544 CATGAGGGGAAGCTGGTGGAGGG + Intronic
1022494270 7:30843484-30843506 CTTCTGGGGGAACTTGTGGATGG + Intronic
1022689720 7:32636926-32636948 CATTAGAGGGAGGTGGTGGGTGG - Intergenic
1022864906 7:34407191-34407213 CTTGAGATGGGGCTGTTGGAGGG + Intergenic
1022917289 7:34971105-34971127 CATTAGAGGGAGGTGGTGGGTGG - Intronic
1023797802 7:43808272-43808294 GTTCAGAGGGAGAAGGTGGCTGG - Intergenic
1024191711 7:47018548-47018570 CATGGGAGGGACCTGGTGGAAGG - Intergenic
1024191831 7:47019923-47019945 CATAGGAGGGACCTGGTGGAAGG - Intergenic
1024274232 7:47664931-47664953 CAACAGAGGGAGCTCGTGGTGGG + Intergenic
1024637270 7:51301135-51301157 CGCCGGAGGGAGCCGGTGGAGGG - Intronic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1026656021 7:72257235-72257257 CTAGTGAGGGACCTGGTGGAAGG - Intronic
1029037648 7:97539113-97539135 TGTCAGAGGGACCTGGTGGGAGG - Intergenic
1029436777 7:100568157-100568179 CTGCAGGGGGACCTGGTTGATGG + Exonic
1031287155 7:119885180-119885202 CCTGAGAGGGACCTGGTGGGAGG - Intergenic
1031341346 7:120605927-120605949 CATAGGAGGGACCTGGTGGAAGG + Intronic
1031397059 7:121286225-121286247 CATTAGAGGGACCTGGTGGGAGG - Intronic
1032024997 7:128434235-128434257 CCTCAGAGGGACCTGGTGGGAGG - Intergenic
1032332175 7:130990779-130990801 CAGCAGAGGGAGATGGTGCAGGG - Intergenic
1032452136 7:132041528-132041550 CATGGGAGGGACCTGGTGGAAGG - Intergenic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1033560521 7:142526385-142526407 CGACAGAAGGACCTGGTGGAAGG + Intergenic
1033579002 7:142714546-142714568 CTCCAGAAGAAGCTGGTGAAAGG - Intergenic
1033853159 7:145523132-145523154 CATGGGAGGGACCTGGTGGAAGG - Intergenic
1034409446 7:150932163-150932185 CTGCAAAGGGGGCTGGTGAATGG + Intergenic
1034441623 7:151088592-151088614 CTCCAGAAGGAGCTGGGGGAAGG - Intronic
1034926682 7:155128324-155128346 CATGAGAGGGACCTGGTGGGAGG + Intergenic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1035061316 7:156071632-156071654 CTTCACAGAAAGCTGGTGGCAGG - Intergenic
1035085292 7:156252998-156253020 CTTCCGGGGCTGCTGGTGGATGG + Intergenic
1035298959 7:157884789-157884811 CGTGAGAGGGAACTGGTGGGAGG - Intronic
1035425757 7:158771662-158771684 CTTCAGATGGAGCCGGTGTTGGG - Intronic
1035455688 7:159007102-159007124 CTTCAGAGGGGTCAGGTGGGAGG + Intergenic
1035489160 7:159257245-159257267 CTTCAAAGGGAGTTGCTGGCTGG + Intergenic
1035679349 8:1476774-1476796 CTGCAGAAGGGGCTGGTGGGTGG - Intergenic
1035679362 8:1476826-1476848 CTGCAGAAGGGGCTGGTGGGTGG - Intergenic
1036571374 8:9982531-9982553 CATGAGAGGGACCTGGTGGGAGG + Intergenic
1037713013 8:21370571-21370593 ATTAACAGTGAGCTGGTGGAAGG + Intergenic
1038143888 8:24875970-24875992 CTTCTCAGGAAGCTGGGGGATGG + Intergenic
1038421357 8:27436046-27436068 CTTCAGAGGGAGCAGGGTGATGG + Intronic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1038878095 8:31574372-31574394 CATAGGAGGGACCTGGTGGAAGG + Intergenic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040598284 8:48860948-48860970 CTGCAGCTGGAGCTGATGGAGGG + Intergenic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1041928552 8:63263675-63263697 CAGCAGAAGCAGCTGGTGGATGG + Intergenic
1043198894 8:77338152-77338174 CTTCCAAGGGACCTGGTGGGAGG + Intergenic
1043805777 8:84670742-84670764 CTTCAGAAGGACCTGGTGGGAGG - Intronic
1044744337 8:95357618-95357640 ATTTAGAGGGATCTGGAGGAGGG + Intergenic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1045884553 8:107079954-107079976 CCTGAGAGGGACCTGGTGGGAGG - Intergenic
1046519573 8:115307120-115307142 ATTAAGAGGGAGCTTGTAGAGGG - Intergenic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1047151217 8:122265284-122265306 CTTGGGAGGGAGCTGGTGGGAGG - Intergenic
1047506735 8:125486224-125486246 GTTCTGATGGAGCTGGTGGATGG - Intergenic
1048579797 8:135721514-135721536 CATGAGAGGAAGCTGGTGAAGGG - Intergenic
1048782324 8:138016123-138016145 CTTGGGAGGGACTTGGTGGAAGG + Intergenic
1049040658 8:140110223-140110245 CTACAGGGGGAGCTGCTGTAGGG - Intronic
1049040790 8:140110697-140110719 GTTCAGGGGGAGCTGCTGCAGGG - Intronic
1049040805 8:140110747-140110769 CTTCAGGGGGAGCTACTGTAGGG - Intronic
1049237500 8:141519408-141519430 CTGCAGAGGGAGGTGGTCCAGGG - Intergenic
1049249099 8:141578646-141578668 CTTCAGAATGGGCTGGTGGAAGG - Intergenic
1049258251 8:141625216-141625238 CATCAGGGGGAGCTGGGGAACGG + Intergenic
1049630239 8:143650209-143650231 CTTCAGAGAGAGCTCATAGAGGG + Exonic
1050236562 9:3587271-3587293 CAGGGGAGGGAGCTGGTGGAAGG + Intergenic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1051410283 9:16782583-16782605 CTTCAGAGTCAGCCAGTGGAAGG - Intronic
1051802433 9:20951225-20951247 CGTCAGAGGGAAATGGTGTATGG + Intronic
1052088091 9:24292253-24292275 CATGAGAGGGATCTGGTGGGAGG - Intergenic
1052264969 9:26561493-26561515 CATGGGAGGGACCTGGTGGAAGG + Intergenic
1053096916 9:35336626-35336648 CTTCCCAAGTAGCTGGTGGAAGG + Intronic
1053416423 9:37949679-37949701 CATCAGAGGGTGCTGATGGGAGG + Intronic
1053675236 9:40419394-40419416 TGTCAGAGGGACCTGGTGGGAGG + Intergenic
1053925021 9:43045729-43045751 TGTCAGAGGGACCTGGTGGGAGG + Intergenic
1054288509 9:63257920-63257942 TGTCAGAGGGACCTGGTGGGAGG + Intergenic
1054386335 9:64559457-64559479 TGTCAGAGGGACCTGGTGGGAGG + Intergenic
1054509384 9:65956898-65956920 TGTCAGAGGGACCTGGTGGGAGG - Intergenic
1054991976 9:71338350-71338372 CTTCAGAGGGAAATGGCGGAAGG + Intronic
1055171619 9:73266031-73266053 CTTCAGAGGATGCAGGTGGTAGG + Intergenic
1056486365 9:87062169-87062191 CTTCAGAAGGAGCTAGTTTAGGG + Intergenic
1056999487 9:91494309-91494331 CATGAGAGGGACCTGGTGGGAGG - Intergenic
1057280603 9:93708534-93708556 CTCCAGAGGGTGCTGCTGGGAGG + Intergenic
1057442840 9:95094490-95094512 CTTCCCAGGGACCTGGGGGAGGG - Intergenic
1057736630 9:97668314-97668336 CTTCAGAGTGAGCTGGGGGCAGG + Intronic
1057761265 9:97876497-97876519 CTTAAGAGGGAGATGGAGGAAGG + Intergenic
1058737065 9:107903567-107903589 CTTCAGAGATAGCCCGTGGACGG + Intergenic
1060300607 9:122372566-122372588 CCTCACAGTGAGCTGGTGGTGGG + Intronic
1061127427 9:128685733-128685755 CTTCAAAGGGAGCCGGGGGCCGG + Intronic
1062160464 9:135076792-135076814 ATTCTGAGGGAGATGGAGGAAGG - Intronic
1062207088 9:135343183-135343205 GCTCAGTGGGACCTGGTGGAGGG - Intergenic
1062253840 9:135611665-135611687 CCTCAGTGGGAGCTTCTGGAGGG - Intergenic
1062291577 9:135797638-135797660 CTTCTGGGGGAGCTGGTAGACGG - Intergenic
1062406975 9:136401271-136401293 CTTCACACGCATCTGGTGGATGG + Intergenic
1062539711 9:137036138-137036160 CTCAAGTGGGAACTGGTGGAGGG + Exonic
1185820549 X:3198843-3198865 CATGGGAGGGAGCTGGTGGAAGG + Intergenic
1187492002 X:19760940-19760962 CTTCTGAGGGAGCCAGTGCACGG - Intronic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1188461782 X:30435516-30435538 CATAAGAGGGAGCAGGAGGAGGG - Intergenic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1190214195 X:48469123-48469145 CTCCGGAGGGTGCTGGTGGTGGG - Intronic
1190874994 X:54453426-54453448 CTTCTGAGGGACCAGGTGAAAGG - Intronic
1191746223 X:64490924-64490946 CATAGGAGGGACCTGGTGGAAGG + Intergenic
1192800825 X:74463111-74463133 CTGCAGAGGGAGAGGATGGATGG + Intronic
1193143615 X:78055005-78055027 CATGAGAGGGACCTGGTGGGAGG + Intergenic
1193158267 X:78198026-78198048 CTTCAGGGGAGGCAGGTGGATGG + Intergenic
1193655196 X:84188990-84189012 TCTCAGAGGGGGCTGGAGGATGG - Intergenic
1194455998 X:94104470-94104492 CATGTGAGGGACCTGGTGGAAGG - Intergenic
1194469216 X:94271875-94271897 CATGAGAGGGACCTGGTGGGAGG + Intergenic
1194943089 X:100036224-100036246 CTACAGAGTGAGCTTCTGGAGGG - Intergenic
1196498687 X:116351686-116351708 CGTCAGAGGGACCTGGTGGGAGG + Intergenic
1196576196 X:117322020-117322042 CATGGGAGGGAACTGGTGGAAGG + Intergenic
1199749512 X:150801526-150801548 CTAGGGAGGGACCTGGTGGAAGG - Intronic
1200079066 X:153566599-153566621 CTGCAGAGGGTGGTGTTGGAGGG - Intronic
1200087186 X:153613001-153613023 CTGCACACGGAGCTGGTGGGTGG + Intergenic
1201616828 Y:15909685-15909707 CCTCAGAGGAAGCAGGTGAATGG + Intergenic