ID: 1143940758

View in Genome Browser
Species Human (GRCh38)
Location 17:10538722-10538744
Sequence GGCATTGCAGAGGATATAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 192}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143940758 Original CRISPR GGCATTGCAGAGGATATAGA AGG (reversed) Intronic
900721854 1:4181601-4181623 GTCATTAGAGAGGATACAGAAGG + Intergenic
902060730 1:13640423-13640445 CACATGGCAGAGGAAATAGAAGG + Intergenic
902180025 1:14680968-14680990 GTCATGGCAGAAGATGTAGAGGG + Intronic
906060427 1:42944846-42944868 GGCAATGCAGAGGATTTAGAGGG - Intronic
906203327 1:43973797-43973819 GGCATTGTCGAGGGTATTGAAGG + Intergenic
906400590 1:45501412-45501434 GTCCTGGGAGAGGATATAGAGGG + Intronic
907412426 1:54292147-54292169 GGCAGTGCAGGGGAGAAAGAGGG - Intronic
908067227 1:60419924-60419946 GGCATTGCACTGGACATTGAAGG + Intergenic
908917490 1:69146928-69146950 AGCATGCCAGAGGATATAGCTGG + Intergenic
909100716 1:71344429-71344451 GGAAATGAAGAAGATATAGAAGG - Intergenic
910276362 1:85453505-85453527 GGCATAGAAGAGCATATATAAGG + Intronic
910458130 1:87420209-87420231 GGCATTCCAGAGGAAAGTGATGG - Intergenic
911348856 1:96727534-96727556 GGCATTAAAGAGGATGTGGAAGG - Intronic
911400359 1:97367051-97367073 TGCATTGCATATGAGATAGAGGG + Intronic
915811060 1:158911045-158911067 GGCCTTGAAGAGGAGAGAGAGGG + Intergenic
916106641 1:161437564-161437586 GGCATTGGAATGGATATTGAGGG - Intergenic
916206351 1:162319508-162319530 GGGATTGCAGGGCATACAGAAGG - Intronic
916321411 1:163509046-163509068 GGTATTGATTAGGATATAGAAGG - Intergenic
916779117 1:168004646-168004668 GACATTGTAGAGGATGTAGAAGG - Exonic
917641615 1:176988295-176988317 GAAATTGCAGAGGATATATTGGG + Intronic
918471196 1:184876268-184876290 GGCACTACAGAGAATAAAGAGGG + Intronic
918621698 1:186612930-186612952 GGCATTGGGGAGGATATATTGGG + Intergenic
921687013 1:218101638-218101660 GTCACTGCACAGGATATTGATGG + Intergenic
1062962219 10:1581122-1581144 TGTATTGGCGAGGATATAGAGGG - Intronic
1066625016 10:37397293-37397315 GGCATAGCTGAGGATATAATTGG - Intergenic
1067535385 10:47105711-47105733 GGCATTGCAGAGGAGTTATCTGG - Intergenic
1068364081 10:56021744-56021766 GGCAGTGTAGAGTATATATATGG - Intergenic
1069395141 10:67979493-67979515 GGCCTTAAAGAGGAGATAGATGG + Intronic
1070251445 10:74776993-74777015 GGAAATGAAGAGGATTTAGATGG - Intergenic
1071053414 10:81479185-81479207 GGCATTGCAGAAAATGTATAGGG - Intergenic
1072617074 10:97057027-97057049 GGCTCTGCAGAGGCTAGAGAAGG - Intronic
1073281216 10:102355618-102355640 AGCTTTGCAGAAGATAGAGAAGG + Intronic
1074411874 10:113235595-113235617 GGAAATGCAGAGGACATAGGAGG + Intergenic
1075356334 10:121780393-121780415 GGCAATGGAGAGGAAATGGATGG - Intronic
1075644973 10:124091532-124091554 GGAATTGCAGCTGATAAAGAGGG + Intronic
1076022190 10:127082994-127083016 GCCTCTGCAGTGGATATAGAAGG - Intronic
1077435690 11:2538086-2538108 CTCATTCCAGAGGATATACACGG - Intronic
1085821495 11:79798548-79798570 GGATTTGCAGAGAAAATAGAGGG - Intergenic
1085850849 11:80117924-80117946 GGCATTGGAGAGGAGCTGGAGGG - Intergenic
1086217279 11:84399191-84399213 GGTAGTGAAGAGGATACAGAGGG - Intronic
1086564684 11:88212141-88212163 GGCAGTGCAGAGGATAAATGTGG - Intergenic
1087953592 11:104256237-104256259 GGCATTGCAGATAATTTAAATGG + Intergenic
1090204266 11:124876141-124876163 GGCAGTGCTGAGGATCTTGACGG + Intronic
1091037278 11:132245414-132245436 GGGATTGCAGAGGAGAGAGCAGG + Intronic
1093229052 12:16520651-16520673 GACAATGCAGAGGATAGGGAGGG - Intronic
1093719516 12:22422983-22423005 GGCCTTTCAGAGGATGGAGAAGG + Intronic
1093720013 12:22429623-22429645 GGCCTTTCAGAGGATGGAGAAGG + Intronic
1096304970 12:50466212-50466234 GGCTTGTCAGAGGATATATAGGG + Intronic
1098121992 12:67251096-67251118 TCCTTTGCAGAAGATATAGAAGG + Intergenic
1100438046 12:94589920-94589942 GGCATTGCAGAGGTTCTCGCGGG - Intronic
1101690475 12:107075094-107075116 TGCTTTGCACAGGGTATAGAAGG - Intronic
1104530236 12:129563392-129563414 TGCATAGCTGAGGATATAGATGG + Intronic
1105894890 13:24709356-24709378 GGCAATGGAGGGGATCTAGAGGG - Exonic
1106786920 13:33116450-33116472 AGCATGGCAGAGCATATGGATGG - Intronic
1108945746 13:56020279-56020301 TGCATTGAAGAGGATAGAAAGGG - Intergenic
1109637744 13:65145004-65145026 GGTTTTGCAGAAGAAATAGATGG + Intergenic
1111567449 13:90033826-90033848 GCCAGTGCATAGGAAATAGATGG - Intergenic
1112920618 13:104607351-104607373 GGTATTGCCGAGGATATTGAAGG - Intergenic
1115797168 14:36950985-36951007 GCCATTGCTGAGGAAATGGAGGG - Intronic
1118241298 14:64061036-64061058 GGCATGGAAGAGGATAAAAAAGG - Intronic
1120394837 14:83955856-83955878 GGAAATGAAGAGGATTTAGATGG - Intergenic
1121510010 14:94505509-94505531 GGGGTTGCAGAGGAGACAGAAGG + Intronic
1123142231 14:106091399-106091421 GGCATGGCAGCAGATCTAGAAGG + Intergenic
1123186401 14:106521397-106521419 GGCATGGCAGCAGATCTAGAAGG + Intergenic
1123885798 15:24726982-24727004 GGTATTTCAGAGGATATTTATGG - Intergenic
1124388768 15:29233885-29233907 GACATTGTAGAGGATGTAGATGG + Intronic
1124693611 15:31845678-31845700 GGCATTGCAGAGGTGCTAGGAGG - Intronic
1125223697 15:37369849-37369871 TGGATTGCAGAGGATAGAGCAGG + Intergenic
1125422799 15:39521405-39521427 AGCATTGCAGAGGAGATGCACGG + Intergenic
1129605327 15:77022179-77022201 GACATTGCTGAGGATATTGGCGG + Intronic
1130368684 15:83264117-83264139 GGCATTGTAGTGGATTTTGAGGG + Exonic
1130693171 15:86104178-86104200 GGTATTGGGGAGGATAAAGATGG + Intergenic
1130748807 15:86687131-86687153 GGCATTGAAAAGGCTATATATGG + Intronic
1131114028 15:89783425-89783447 GACATTGCAGAGGAGAGAGCTGG - Intergenic
1131273465 15:90960843-90960865 GGCATGGCAGAGGATCCCGAGGG - Intronic
1135037937 16:19093916-19093938 GGCTTTGCAGAAGAAATGGAAGG + Intergenic
1136232434 16:28894564-28894586 GTCATTGCAGAGGGCACAGATGG - Exonic
1138607737 16:58099609-58099631 GGGGCTGCAGAGGATAGAGACGG - Intergenic
1142281220 16:89148693-89148715 GGCAGTGAAGAGGAGAAAGATGG - Intronic
1143042681 17:4050882-4050904 GCCAGTGCAGAGGATGTGGATGG - Exonic
1143940758 17:10538722-10538744 GGCATTGCAGAGGATATAGAAGG - Intronic
1145272995 17:21414611-21414633 GGCAGTGCTGTGGATATAGCAGG + Intronic
1145311196 17:21702055-21702077 GGCAGTGCTGTGGATATAGCAGG + Intronic
1146955575 17:36934902-36934924 GGCAGGGCAGAGGATGGAGAAGG - Intergenic
1147627433 17:41909194-41909216 GGGGTTGCAGAGGAGATGGAAGG - Intronic
1149096735 17:52850739-52850761 GACTTTTCAGTGGATATAGATGG + Intergenic
1150010681 17:61499957-61499979 GGCATTGCAGTGGAAAAGGATGG + Intergenic
1150199431 17:63339113-63339135 GGCAGTGAGGAGGATAAAGATGG + Intronic
1150837515 17:68577757-68577779 GGCTGTGCAGAAGCTATAGAAGG - Intronic
1151343906 17:73489733-73489755 AGCCTTGCAGCAGATATAGAGGG - Intronic
1151448862 17:74185229-74185251 GGCAGTGGAGAGGATGCAGACGG - Intergenic
1151823703 17:76511976-76511998 GGCATTGCACAATATAAAGATGG + Intergenic
1152053967 17:78007198-78007220 AGTATTTTAGAGGATATAGAAGG - Intronic
1153185675 18:2483465-2483487 GGGATTCCTGAGGAAATAGAGGG - Intergenic
1156187461 18:34679532-34679554 GCCATTTCAAAGAATATAGATGG + Exonic
1157085558 18:44577061-44577083 GGCAATGGAGAGGATATAGAGGG - Intergenic
1157321849 18:46640819-46640841 GACGTTGGAGAGGAGATAGAGGG - Intronic
1159298098 18:66523119-66523141 GGAATTGCAGAAAATACAGATGG - Intronic
1160537526 18:79603050-79603072 GGTATTGCAAAGGATACAGATGG - Intergenic
1165235378 19:34416667-34416689 GACATTTCAGAGCAAATAGATGG + Intronic
1168589383 19:57619905-57619927 GTCATTGCAGAGGATTAAGTTGG + Intronic
926358677 2:12064919-12064941 GGCATTGCACACTATAAAGATGG - Intergenic
927908028 2:26875877-26875899 GGCATTCCAGATGAATTAGACGG + Intronic
927911720 2:26904437-26904459 GTCATTGCAGAGCTTAAAGACGG - Intronic
927977705 2:27351826-27351848 GGCATTGCAGAGGAATTGAAGGG - Intronic
928892117 2:36216291-36216313 GGCACTGCAGAGGTTATTCATGG + Intergenic
929460318 2:42098511-42098533 GGCATGGCAGAGGAGAGGGAAGG - Intergenic
932571175 2:72939153-72939175 GGCATTCCAGAGGACAGCGATGG - Intergenic
934087202 2:88519779-88519801 GGAATTGCTGATGATATAGGTGG - Intergenic
934620305 2:95799483-95799505 GGCACTGAAGAAGATACAGATGG - Intergenic
934640588 2:96025080-96025102 GGCACTGAAGAAGATACAGATGG + Intronic
934969697 2:98753119-98753141 GGAAATGCAGAGGATGTAGATGG - Intergenic
935586140 2:104801713-104801735 GGGATTGCAGAGGGGATTGAGGG + Intergenic
936433588 2:112484012-112484034 GGCACTGCCAAGAATATAGAGGG - Intronic
936595141 2:113840368-113840390 GGCATTACAAAGGATACAGACGG - Intergenic
937146073 2:119645939-119645961 CACATTTCAGATGATATAGAAGG - Intronic
938323210 2:130379555-130379577 GGCATTGGGGAGGAGAAAGAAGG - Intergenic
939054318 2:137344826-137344848 GGGAATGCAGAGGATATGCAAGG - Intronic
939775608 2:146383912-146383934 GGCAATGCAGAGGAAATCAAAGG + Intergenic
940525725 2:154811205-154811227 TGCATTCCAGAAGATTTAGAAGG - Intronic
943945516 2:194057028-194057050 CTCATTACTGAGGATATAGATGG - Intergenic
946200005 2:218065828-218065850 GGCATTGCAGGGGTTAAAGGAGG - Intronic
946257143 2:218451443-218451465 GTCATTTCAGAGGACAGAGAAGG + Exonic
1169449521 20:5699639-5699661 GGCATTGAAAAGGGTAGAGAAGG - Intergenic
1170015655 20:11778905-11778927 GGCATGGGAGAGGAAATGGATGG + Intergenic
1170941651 20:20853266-20853288 GGCAGTGCAGAGGATAAATATGG - Intergenic
1171028256 20:21652628-21652650 GGAAATGAAGAGGATTTAGATGG - Intergenic
1172446639 20:34996841-34996863 GGCATTGCAGAGGTTAAGGGTGG + Intronic
1173448872 20:43144432-43144454 GTCATTGCAGTGGGGATAGAAGG - Intronic
1174700987 20:52609246-52609268 AGCATTGCAGAGGCTGTAGGGGG - Intergenic
1175194500 20:57233554-57233576 GGCATGGCAGAGGATCATGAAGG - Intronic
1178614954 21:34124561-34124583 GGGAGTGCTGAGGAGATAGACGG - Intronic
1182164612 22:28160868-28160890 GCCAATGCAGAAGATACAGAAGG + Intronic
1182945325 22:34316423-34316445 GGCAGTGCAGAGGAGAAATACGG + Intergenic
1182979588 22:34656328-34656350 GGAAATGGAGAGGAGATAGATGG + Intergenic
1183407234 22:37636325-37636347 GGCATTTCAGAGGCTTAAGATGG - Intronic
1183521613 22:38298941-38298963 GGTGTTGCAGAGGATAGAGAAGG + Intronic
950197359 3:11018231-11018253 GCCCTTGCAGAGGAAATAGATGG - Intronic
952265406 3:31780920-31780942 AGTATTGCAGAAGATAAAGAGGG + Intronic
955046281 3:55363415-55363437 AGCATTTCAGAGGAAATAGAAGG - Intergenic
957187736 3:76964612-76964634 GGCAATGCAGATGATATATTAGG - Intronic
957710729 3:83855779-83855801 GGCTTTGAAGAGGATGAAGATGG - Intergenic
959094488 3:101938860-101938882 GGTATCACAGAGGCTATAGAAGG - Intergenic
960002663 3:112749155-112749177 GGCATTGAACAGGAAATATAGGG + Intronic
961506159 3:127371880-127371902 CGCAATGCAGAGGAGACAGATGG + Intergenic
961821660 3:129578430-129578452 GGCTCTGCAGAGGAAACAGAAGG + Exonic
963789051 3:149564534-149564556 CGCATTACAGAGAAAATAGAGGG + Intronic
965495885 3:169398599-169398621 CGCATTCCAGAGGATATATATGG - Intronic
966797282 3:183727608-183727630 GGCATAGATGAGCATATAGAAGG + Intronic
967735835 3:192951548-192951570 GGCATTCTAGAGGTTATTGATGG + Intergenic
973581646 4:52349828-52349850 GGAAATGAAGAGGATTTAGATGG + Intergenic
974734478 4:65911911-65911933 GGCAATGCAGAGCAGATATATGG - Intergenic
976508144 4:85873476-85873498 TGCAGTGCAGAGGATTTACAAGG + Intronic
976745705 4:88401049-88401071 GTTATTGCAGAGGAGAGAGAAGG + Intronic
983991349 4:174123876-174123898 AAGATTGCAGAGGAGATAGAAGG - Intergenic
984097497 4:175450299-175450321 GGAAATGAAGAGGATTTAGATGG + Intergenic
992509403 5:77418305-77418327 TGCATTGCAGAGGAAAGAGTTGG - Exonic
994609530 5:102018892-102018914 GCCATTGCAGAGGATTGAGTAGG + Intergenic
994636061 5:102345568-102345590 GGAAATGAAGAGGATTTAGATGG + Intergenic
995478603 5:112572722-112572744 GGCAATGCTGATGATAGAGAAGG + Intergenic
998581840 5:143384904-143384926 GGCAGTGCAGAGGAGATACATGG - Intronic
1001237627 5:170043453-170043475 TGCATTGCAGAGGAGAGGGAGGG - Intronic
1003348606 6:5294695-5294717 GATATTGCAAAGGATACAGACGG + Intronic
1004657291 6:17675635-17675657 GGGAATGCCGAGGATGTAGATGG + Exonic
1009473637 6:64060371-64060393 TGCAATGCAGAGGATATATGTGG + Intronic
1009680104 6:66880986-66881008 GGCAGTGCAGAGGAGATATGTGG - Intergenic
1010055148 6:71556346-71556368 GGCAGTGCAGAGGAAATGTAGGG + Intergenic
1010889554 6:81289823-81289845 GGCATTGCAGAAGTGAAAGATGG + Intergenic
1013853693 6:114545662-114545684 GGAATTGCTGAAGATAGAGAAGG + Intergenic
1018536408 6:164825334-164825356 GGCACTGCAGAGGAAACAGAGGG - Intergenic
1019148847 6:169991026-169991048 GTGATTGCAGAGGACACAGAAGG - Intergenic
1019272209 7:156645-156667 GGCAGGGCAGAGGGTACAGATGG - Intergenic
1023522773 7:41065415-41065437 GGTATTTCAGAGGATAAAAAGGG + Intergenic
1023660828 7:42469349-42469371 GACATTGGAGAGGACACAGAGGG - Intergenic
1025221451 7:57113395-57113417 CTCATTGCAGAGGAAAAAGAAGG - Intergenic
1025632237 7:63285065-63285087 CTCATTGCAGAGGAAAAAGAAGG - Intergenic
1025650322 7:63461164-63461186 CTCATTGCAGAGGAAAAAGAAGG + Intergenic
1026189314 7:68110258-68110280 AACATGGCAGAAGATATAGAGGG - Intergenic
1026295604 7:69049286-69049308 GGCATTGCATAGAATAGAGGAGG + Intergenic
1028650947 7:93150268-93150290 GGAAATGAAGAGGATTTAGATGG - Intergenic
1030338439 7:108350165-108350187 GCCATTTCAGAGAGTATAGAGGG - Intronic
1033539857 7:142346495-142346517 GGCATTGCAGAGGGGAGTGAGGG - Intergenic
1033543486 7:142378932-142378954 GGCATTGCAGAGGTGTTCGAGGG - Intergenic
1034717767 7:153259480-153259502 GGAATAGCAGAGGATAAAGCTGG - Intergenic
1035129479 7:156639643-156639665 GGAACAGCAGAGGATACAGAGGG + Exonic
1037095502 8:14981578-14981600 GGGATAGAAGAGAATATAGAGGG - Intronic
1040879422 8:52189404-52189426 GCCATTACAAAGGATAAAGAAGG + Intronic
1042051042 8:64707417-64707439 GGCATTGAAGAGGTTATAGTAGG + Intronic
1042942622 8:74123124-74123146 GGCCAAGCAGAGGAGATAGAGGG - Intergenic
1043881349 8:85546962-85546984 GACATGGCAGAGGAGAAAGACGG + Intergenic
1044752577 8:95430538-95430560 GGCAGTGAAGAGGATGTAGAAGG + Intergenic
1046861735 8:119100565-119100587 GGTACAGCAGAGGATATAGTTGG - Intronic
1047560994 8:125988062-125988084 GGCATGGCAGTGAATATACAGGG + Intergenic
1048990543 8:139757767-139757789 GGCAGTGCAGGTGATGTAGAAGG - Intronic
1056538221 9:87549701-87549723 TGCATTGCTGAGGCTCTAGAAGG - Intronic
1058100649 9:100915015-100915037 GTCATTGCAGAGGAGACATAGGG - Intergenic
1058850142 9:109003809-109003831 GACTTTGGAGAGGATATGGATGG + Intronic
1059367074 9:113794668-113794690 GGCATTTCACAGGTTGTAGAGGG - Intergenic
1186492527 X:9985282-9985304 GGGATTGCAGAGGATTTTTAGGG + Intergenic
1188485777 X:30680431-30680453 GGGGTTGGTGAGGATATAGAGGG + Intronic
1189948563 X:46204869-46204891 GGAATTGCAGAGGCTTAAGAAGG - Intergenic
1191076668 X:56460878-56460900 GCCATTGCAGAGGATTGAGTAGG - Intergenic
1193256491 X:79355112-79355134 GGCATTGCAGAGGAGAAATATGG + Intergenic
1193821957 X:86175742-86175764 GGGAAGGCAGAGTATATAGATGG + Intronic
1193940405 X:87674911-87674933 GCTAATGCAGAGGATATGGAAGG + Intergenic
1194554201 X:95337490-95337512 GGCAATGCAGAGGGGATATATGG - Intergenic
1194572870 X:95574534-95574556 GGCAGTGCAGAGGGGAAAGATGG + Intergenic
1194950557 X:100121006-100121028 AGCATGGCTGAGGAAATAGAAGG - Intergenic
1195735624 X:108009751-108009773 GACAAGGCTGAGGATATAGAAGG + Intergenic
1196560493 X:117141702-117141724 GGCACTGTGGAGGACATAGATGG - Intergenic
1198798088 X:140420948-140420970 TGCATTGCAGAGAATATATAGGG - Intergenic
1199162059 X:144624588-144624610 TGCATACCAGAGGAAATAGAAGG - Intergenic
1201913614 Y:19158482-19158504 GCCATTGCTGAGGCTAGAGAAGG + Intergenic