ID: 1143940860

View in Genome Browser
Species Human (GRCh38)
Location 17:10539986-10540008
Sequence CGGGGGCTGTGATGCATTAT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 2, 2: 1, 3: 8, 4: 86}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143940860_1143940862 -8 Left 1143940860 17:10539986-10540008 CCCATAATGCATCACAGCCCCCG 0: 1
1: 2
2: 1
3: 8
4: 86
Right 1143940862 17:10540001-10540023 AGCCCCCGTGAGCTTGTAAATGG 0: 1
1: 0
2: 0
3: 4
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143940860 Original CRISPR CGGGGGCTGTGATGCATTAT GGG (reversed) Exonic
900069702 1:761167-761189 TGGGGGCTGTAGTGCATTTTTGG - Intergenic
900346034 1:2210609-2210631 CGGGGGCTGTGAAGCTTTCTGGG + Intronic
905328998 1:37178986-37179008 AGGGGGCTGTTATGCATCACAGG + Intergenic
910861390 1:91745491-91745513 TGGGGGCTGTGATGAGTTCTAGG - Intronic
916019439 1:160779097-160779119 CTGGGGTTCTGATGCAGTATGGG + Intergenic
920315367 1:205072818-205072840 CAGGGGCAGTGATGGACTATGGG + Intronic
922105074 1:222506636-222506658 TGGGGGCTGTAGTGCATTTTTGG - Intergenic
922265389 1:223979155-223979177 TGGGGGCTGTAGTGCATTTTTGG - Intergenic
924347248 1:243084158-243084180 TGGGGGCTGTAGTGCATTTTTGG - Intergenic
1063145242 10:3290041-3290063 CGGGGGCGGTGATGCCTTACGGG - Intergenic
1065081394 10:22133299-22133321 TGGGGACTGAGATGCATTAGTGG - Intergenic
1066729104 10:38420719-38420741 TGGGGGCTGTAGTGCATTTTTGG + Intergenic
1076973831 11:155931-155953 TGGGGGCTGTAGTGCATTTTTGG - Intergenic
1077490315 11:2858055-2858077 CGGGGGCTGTGGAGCGTTTTCGG - Intergenic
1080870848 11:36235741-36235763 GGGGAGCTGTGATGAAATATTGG + Intergenic
1082044743 11:47715501-47715523 CTGGGGCTGTGATGTATGAGGGG - Intergenic
1101564898 12:105895865-105895887 CAGGGGCTGTGATCCAGTAGGGG - Intergenic
1104150340 12:126075902-126075924 AGGGGTCTGTGATTCATTACAGG + Intergenic
1104670997 12:130680128-130680150 CAGGAGCTCTCATGCATTATTGG + Intronic
1114083388 14:19220079-19220101 AGTGGGCTCTGATGCATGATGGG - Intergenic
1122497355 14:102167848-102167870 CAGTGCCTTTGATGCATTATAGG + Intronic
1123098765 14:105779988-105780010 GGGGAGCTTTAATGCATTATTGG - Intergenic
1202895002 14_GL000194v1_random:1848-1870 AGTGGGCTCTGATGCATGATGGG - Intergenic
1137838874 16:51621774-51621796 TGGGGGATGTGATTCATTTTGGG + Intergenic
1141870572 16:86782777-86782799 CGGGGGCTGAAATGCAGTTTGGG - Intergenic
1142353705 16:89591270-89591292 CGGGGGGTGTGGTGCATGCTTGG + Intronic
1142446432 16:90141754-90141776 TGGGGGCTGTAGTGCATTTTTGG + Intergenic
1142461073 17:93709-93731 TGGGGGCTGTAGTGCATTTTTGG - Intergenic
1143923642 17:10350614-10350636 CGGGAGCCGTGATGCATTATGGG - Exonic
1143930131 17:10413960-10413982 CAGGGGCTGTGATGCATTATGGG - Exonic
1143933803 17:10460974-10460996 CTGGAGCCGTGATGCATTATGGG - Exonic
1143938469 17:10512466-10512488 CAGGGGCTGTGATGCATTATGGG - Exonic
1143940860 17:10539986-10540008 CGGGGGCTGTGATGCATTATGGG - Exonic
1143952624 17:10645765-10645787 CGGGAGCCGTGATGCACTACGGG - Exonic
1148794254 17:50189571-50189593 AGGGGGCTCTGGTGCATCATTGG + Intronic
1150491040 17:65574540-65574562 TGGGGGCTGTGATGCTGTACAGG - Intronic
1151765544 17:76131653-76131675 TGGGGGCTGTGATGCTTCAAAGG + Intergenic
1154500072 18:14991742-14991764 AGTGGGCTCTGATGCATGATGGG - Intergenic
1155604742 18:27592117-27592139 GGAGGGCAGTGATGCAATATCGG - Intergenic
1158654662 18:59320126-59320148 GAGGGGGTGTCATGCATTATGGG + Intergenic
1160327418 18:77963700-77963722 CGGGGGCTGTGTTTGACTATGGG - Intergenic
1160650775 19:226076-226098 TGGGGGCTGTAGTGCATTTTTGG - Intergenic
1163789615 19:19298895-19298917 AGGGGACTGTGATGCATCCTTGG - Intronic
925262337 2:2539620-2539642 CAGGGGCTGTGAGGCATAAGCGG + Intergenic
929976319 2:46639009-46639031 GGGAGGCTGTTGTGCATTATAGG + Intergenic
939456465 2:142443464-142443486 CAGGAGCTGTGATTCAGTATTGG + Intergenic
940000606 2:148963313-148963335 CGGGGGCTGTTGTGCAGGATTGG + Intronic
942163828 2:173221337-173221359 CAGGAGCTGTGATGCATTCTGGG + Intronic
944748788 2:202686289-202686311 CTGGAGCTGTAATGCATTGTTGG + Intronic
948771245 2:240252296-240252318 CGGGGGCTCTGTTGCCTTCTCGG - Intergenic
1170534307 20:17324882-17324904 AGGGGGCTGTGAGGCAGTAGGGG - Intronic
1174063600 20:47849267-47849289 CGCAGGCTGTGATGCATTAGTGG - Intergenic
1174072104 20:47906392-47906414 CACAGGCTGTGATGCATTAGTGG + Intergenic
1174147144 20:48459932-48459954 CGCAGGCTGTGACGCATTAGCGG - Intergenic
1174151942 20:48492281-48492303 CACAGGCTGTGATGCATTAGTGG - Intergenic
1175825845 20:61936297-61936319 GGGGGGCTGTGAGGGTTTATAGG - Intronic
1176614705 21:9017835-9017857 AGTGGGCTCTGATGCATGATGGG - Intergenic
1176710506 21:10146036-10146058 AGTGGGCTCTGATGCATGATGGG + Intergenic
1179251839 21:39677349-39677371 CAGGAGCTGTGATGCATGATAGG - Intergenic
1180294587 22:10873188-10873210 AGTGGGCTCTGATGCATGATGGG + Intergenic
1180497393 22:15902602-15902624 AGTGGGCTCTGATGCATGATGGG + Intergenic
951593776 3:24295133-24295155 CGGGGGCTGATATTCTTTATAGG + Intronic
956571751 3:70704148-70704170 AGGGAGCAGAGATGCATTATAGG - Intergenic
959787095 3:110312739-110312761 CAGGGGCTGTTATTCTTTATGGG + Intergenic
960107129 3:113809950-113809972 TGGGGGAAGTGATGCATAATTGG - Exonic
968367057 3:198193911-198193933 TGGGGGCTGTAGTGCATTTTTGG + Intergenic
969583363 4:8078209-8078231 CGGGGGCTGTGATGCAGGCCAGG - Intronic
971501957 4:27327775-27327797 CAGGGCCTGTGCTGCATTATAGG + Intergenic
979332873 4:119436994-119437016 TGGGGGCTGTAGTGCATTTTTGG - Intergenic
985384648 4:189433011-189433033 GTGGGGCTGTAATGCATGATTGG + Intergenic
993915145 5:93735397-93735419 CGGGGGCTGAGATGGACTCTAGG + Intronic
995587168 5:113660104-113660126 CTGTGGCTGTGATGCATTTGTGG - Intergenic
1002726282 5:181299109-181299131 TGGGGGCTGTAGTGCATTTTTGG + Intergenic
1007630394 6:43270064-43270086 GGGGGGCTGTATTGCATGATGGG - Intronic
1012600131 6:101086369-101086391 AGGGGACTGTGATGCTTGATAGG + Intergenic
1017686452 6:156918211-156918233 CAGAGGCTGTGATCCATTGTGGG + Intronic
1022070278 7:26906582-26906604 CGGGGGCTATTATGAAATATTGG + Intronic
1030347801 7:108454660-108454682 CGGAGGCTGGGCTGCTTTATGGG - Intronic
1033565054 7:142570157-142570179 AGGCAGCTGTGCTGCATTATGGG - Intergenic
1045885571 8:107093817-107093839 CGGGGGAGGTTATGCATTAGTGG - Intergenic
1048970873 8:139644424-139644446 CGTGGGCTGTGATCCATTAATGG - Intronic
1053256670 9:36623082-36623104 AGGGGACTGTCATGCATTGTAGG + Intronic
1053647484 9:40131734-40131756 AGTGGGCTCTGATGCATGATGGG + Intergenic
1053758244 9:41332109-41332131 AGTGGGCTCTGATGCATGATGGG - Intergenic
1054328466 9:63729688-63729710 AGTGGGCTCTGATGCATGATGGG + Intergenic
1054537095 9:66244436-66244458 AGTGGGCTCTGATGCATGATGGG - Intergenic
1054923392 9:70564312-70564334 AGGGAGTTGTGATGAATTATAGG - Intronic
1055042010 9:71884352-71884374 CAGGGCCTGAGATGCAATATAGG + Intronic
1058539807 9:105999864-105999886 CGGAAGCTCTGAAGCATTATAGG + Intergenic
1059337620 9:113579131-113579153 TGGTGGCTGTGATGAATCATCGG + Intronic
1060415816 9:123429502-123429524 GGGGGGCAGTGATGCAATCTCGG - Intronic
1062751413 9:138256755-138256777 TGGGGGCTGTAGTGCATTTTTGG + Intergenic
1202795269 9_KI270719v1_random:115031-115053 AGTGGGCTCTGATGCATGATGGG + Intergenic
1196635768 X:118000854-118000876 CTGGGGCTGTTATGTAATATAGG + Intronic
1202172795 Y:22068716-22068738 TGGGGTCTGTGCTGCTTTATTGG + Intergenic
1202218567 Y:22517655-22517677 TGGGGTCTGTGCTGCTTTATTGG - Intergenic
1202324619 Y:23678400-23678422 TGGGGTCTGTGCTGCTTTATTGG + Intergenic
1202546152 Y:25991654-25991676 TGGGGTCTGTGCTGCTTTATTGG - Intergenic