ID: 1143946645

View in Genome Browser
Species Human (GRCh38)
Location 17:10598554-10598576
Sequence GGGGTCTATGAATGGGCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143946645_1143946656 13 Left 1143946645 17:10598554-10598576 CCTGAAGCCCATTCATAGACCCC No data
Right 1143946656 17:10598590-10598612 ACCCCAGGTTGAGAGCTTCTGGG No data
1143946645_1143946653 -2 Left 1143946645 17:10598554-10598576 CCTGAAGCCCATTCATAGACCCC No data
Right 1143946653 17:10598575-10598597 CCTTAGGGCTTCCTGACCCCAGG No data
1143946645_1143946655 12 Left 1143946645 17:10598554-10598576 CCTGAAGCCCATTCATAGACCCC No data
Right 1143946655 17:10598589-10598611 GACCCCAGGTTGAGAGCTTCTGG No data
1143946645_1143946660 30 Left 1143946645 17:10598554-10598576 CCTGAAGCCCATTCATAGACCCC No data
Right 1143946660 17:10598607-10598629 TCTGGGCTGCTCAGCCTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143946645 Original CRISPR GGGGTCTATGAATGGGCTTC AGG (reversed) Intergenic
No off target data available for this crispr