ID: 1143946649

View in Genome Browser
Species Human (GRCh38)
Location 17:10598562-10598584
Sequence AGCCCTAAGGGGTCTATGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143946649_1143946653 -10 Left 1143946649 17:10598562-10598584 CCATTCATAGACCCCTTAGGGCT No data
Right 1143946653 17:10598575-10598597 CCTTAGGGCTTCCTGACCCCAGG No data
1143946649_1143946656 5 Left 1143946649 17:10598562-10598584 CCATTCATAGACCCCTTAGGGCT No data
Right 1143946656 17:10598590-10598612 ACCCCAGGTTGAGAGCTTCTGGG No data
1143946649_1143946655 4 Left 1143946649 17:10598562-10598584 CCATTCATAGACCCCTTAGGGCT No data
Right 1143946655 17:10598589-10598611 GACCCCAGGTTGAGAGCTTCTGG No data
1143946649_1143946660 22 Left 1143946649 17:10598562-10598584 CCATTCATAGACCCCTTAGGGCT No data
Right 1143946660 17:10598607-10598629 TCTGGGCTGCTCAGCCTTCAAGG No data
1143946649_1143946661 23 Left 1143946649 17:10598562-10598584 CCATTCATAGACCCCTTAGGGCT No data
Right 1143946661 17:10598608-10598630 CTGGGCTGCTCAGCCTTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143946649 Original CRISPR AGCCCTAAGGGGTCTATGAA TGG (reversed) Intergenic
No off target data available for this crispr