ID: 1143946650

View in Genome Browser
Species Human (GRCh38)
Location 17:10598573-10598595
Sequence TGGGGTCAGGAAGCCCTAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143946650_1143946661 12 Left 1143946650 17:10598573-10598595 CCCCTTAGGGCTTCCTGACCCCA No data
Right 1143946661 17:10598608-10598630 CTGGGCTGCTCAGCCTTCAAGGG No data
1143946650_1143946660 11 Left 1143946650 17:10598573-10598595 CCCCTTAGGGCTTCCTGACCCCA No data
Right 1143946660 17:10598607-10598629 TCTGGGCTGCTCAGCCTTCAAGG No data
1143946650_1143946662 22 Left 1143946650 17:10598573-10598595 CCCCTTAGGGCTTCCTGACCCCA No data
Right 1143946662 17:10598618-10598640 CAGCCTTCAAGGGTTCTAAGTGG No data
1143946650_1143946655 -7 Left 1143946650 17:10598573-10598595 CCCCTTAGGGCTTCCTGACCCCA No data
Right 1143946655 17:10598589-10598611 GACCCCAGGTTGAGAGCTTCTGG No data
1143946650_1143946656 -6 Left 1143946650 17:10598573-10598595 CCCCTTAGGGCTTCCTGACCCCA No data
Right 1143946656 17:10598590-10598612 ACCCCAGGTTGAGAGCTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143946650 Original CRISPR TGGGGTCAGGAAGCCCTAAG GGG (reversed) Intergenic
No off target data available for this crispr