ID: 1143946655

View in Genome Browser
Species Human (GRCh38)
Location 17:10598589-10598611
Sequence GACCCCAGGTTGAGAGCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143946645_1143946655 12 Left 1143946645 17:10598554-10598576 CCTGAAGCCCATTCATAGACCCC No data
Right 1143946655 17:10598589-10598611 GACCCCAGGTTGAGAGCTTCTGG No data
1143946651_1143946655 -8 Left 1143946651 17:10598574-10598596 CCCTTAGGGCTTCCTGACCCCAG No data
Right 1143946655 17:10598589-10598611 GACCCCAGGTTGAGAGCTTCTGG No data
1143946652_1143946655 -9 Left 1143946652 17:10598575-10598597 CCTTAGGGCTTCCTGACCCCAGG No data
Right 1143946655 17:10598589-10598611 GACCCCAGGTTGAGAGCTTCTGG No data
1143946650_1143946655 -7 Left 1143946650 17:10598573-10598595 CCCCTTAGGGCTTCCTGACCCCA No data
Right 1143946655 17:10598589-10598611 GACCCCAGGTTGAGAGCTTCTGG No data
1143946648_1143946655 5 Left 1143946648 17:10598561-10598583 CCCATTCATAGACCCCTTAGGGC No data
Right 1143946655 17:10598589-10598611 GACCCCAGGTTGAGAGCTTCTGG No data
1143946649_1143946655 4 Left 1143946649 17:10598562-10598584 CCATTCATAGACCCCTTAGGGCT No data
Right 1143946655 17:10598589-10598611 GACCCCAGGTTGAGAGCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143946655 Original CRISPR GACCCCAGGTTGAGAGCTTC TGG Intergenic
No off target data available for this crispr