ID: 1143946660

View in Genome Browser
Species Human (GRCh38)
Location 17:10598607-10598629
Sequence TCTGGGCTGCTCAGCCTTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143946651_1143946660 10 Left 1143946651 17:10598574-10598596 CCCTTAGGGCTTCCTGACCCCAG No data
Right 1143946660 17:10598607-10598629 TCTGGGCTGCTCAGCCTTCAAGG No data
1143946650_1143946660 11 Left 1143946650 17:10598573-10598595 CCCCTTAGGGCTTCCTGACCCCA No data
Right 1143946660 17:10598607-10598629 TCTGGGCTGCTCAGCCTTCAAGG No data
1143946648_1143946660 23 Left 1143946648 17:10598561-10598583 CCCATTCATAGACCCCTTAGGGC No data
Right 1143946660 17:10598607-10598629 TCTGGGCTGCTCAGCCTTCAAGG No data
1143946649_1143946660 22 Left 1143946649 17:10598562-10598584 CCATTCATAGACCCCTTAGGGCT No data
Right 1143946660 17:10598607-10598629 TCTGGGCTGCTCAGCCTTCAAGG No data
1143946652_1143946660 9 Left 1143946652 17:10598575-10598597 CCTTAGGGCTTCCTGACCCCAGG No data
Right 1143946660 17:10598607-10598629 TCTGGGCTGCTCAGCCTTCAAGG No data
1143946645_1143946660 30 Left 1143946645 17:10598554-10598576 CCTGAAGCCCATTCATAGACCCC No data
Right 1143946660 17:10598607-10598629 TCTGGGCTGCTCAGCCTTCAAGG No data
1143946659_1143946660 -9 Left 1143946659 17:10598593-10598615 CCAGGTTGAGAGCTTCTGGGCTG No data
Right 1143946660 17:10598607-10598629 TCTGGGCTGCTCAGCCTTCAAGG No data
1143946654_1143946660 -2 Left 1143946654 17:10598586-10598608 CCTGACCCCAGGTTGAGAGCTTC No data
Right 1143946660 17:10598607-10598629 TCTGGGCTGCTCAGCCTTCAAGG No data
1143946658_1143946660 -8 Left 1143946658 17:10598592-10598614 CCCAGGTTGAGAGCTTCTGGGCT No data
Right 1143946660 17:10598607-10598629 TCTGGGCTGCTCAGCCTTCAAGG No data
1143946657_1143946660 -7 Left 1143946657 17:10598591-10598613 CCCCAGGTTGAGAGCTTCTGGGC No data
Right 1143946660 17:10598607-10598629 TCTGGGCTGCTCAGCCTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143946660 Original CRISPR TCTGGGCTGCTCAGCCTTCA AGG Intergenic
No off target data available for this crispr