ID: 1143946661

View in Genome Browser
Species Human (GRCh38)
Location 17:10598608-10598630
Sequence CTGGGCTGCTCAGCCTTCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143946649_1143946661 23 Left 1143946649 17:10598562-10598584 CCATTCATAGACCCCTTAGGGCT No data
Right 1143946661 17:10598608-10598630 CTGGGCTGCTCAGCCTTCAAGGG No data
1143946657_1143946661 -6 Left 1143946657 17:10598591-10598613 CCCCAGGTTGAGAGCTTCTGGGC No data
Right 1143946661 17:10598608-10598630 CTGGGCTGCTCAGCCTTCAAGGG No data
1143946648_1143946661 24 Left 1143946648 17:10598561-10598583 CCCATTCATAGACCCCTTAGGGC No data
Right 1143946661 17:10598608-10598630 CTGGGCTGCTCAGCCTTCAAGGG No data
1143946659_1143946661 -8 Left 1143946659 17:10598593-10598615 CCAGGTTGAGAGCTTCTGGGCTG No data
Right 1143946661 17:10598608-10598630 CTGGGCTGCTCAGCCTTCAAGGG No data
1143946654_1143946661 -1 Left 1143946654 17:10598586-10598608 CCTGACCCCAGGTTGAGAGCTTC No data
Right 1143946661 17:10598608-10598630 CTGGGCTGCTCAGCCTTCAAGGG No data
1143946658_1143946661 -7 Left 1143946658 17:10598592-10598614 CCCAGGTTGAGAGCTTCTGGGCT No data
Right 1143946661 17:10598608-10598630 CTGGGCTGCTCAGCCTTCAAGGG No data
1143946651_1143946661 11 Left 1143946651 17:10598574-10598596 CCCTTAGGGCTTCCTGACCCCAG No data
Right 1143946661 17:10598608-10598630 CTGGGCTGCTCAGCCTTCAAGGG No data
1143946650_1143946661 12 Left 1143946650 17:10598573-10598595 CCCCTTAGGGCTTCCTGACCCCA No data
Right 1143946661 17:10598608-10598630 CTGGGCTGCTCAGCCTTCAAGGG No data
1143946652_1143946661 10 Left 1143946652 17:10598575-10598597 CCTTAGGGCTTCCTGACCCCAGG No data
Right 1143946661 17:10598608-10598630 CTGGGCTGCTCAGCCTTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143946661 Original CRISPR CTGGGCTGCTCAGCCTTCAA GGG Intergenic
No off target data available for this crispr