ID: 1143946662

View in Genome Browser
Species Human (GRCh38)
Location 17:10598618-10598640
Sequence CAGCCTTCAAGGGTTCTAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143946658_1143946662 3 Left 1143946658 17:10598592-10598614 CCCAGGTTGAGAGCTTCTGGGCT No data
Right 1143946662 17:10598618-10598640 CAGCCTTCAAGGGTTCTAAGTGG No data
1143946650_1143946662 22 Left 1143946650 17:10598573-10598595 CCCCTTAGGGCTTCCTGACCCCA No data
Right 1143946662 17:10598618-10598640 CAGCCTTCAAGGGTTCTAAGTGG No data
1143946657_1143946662 4 Left 1143946657 17:10598591-10598613 CCCCAGGTTGAGAGCTTCTGGGC No data
Right 1143946662 17:10598618-10598640 CAGCCTTCAAGGGTTCTAAGTGG No data
1143946651_1143946662 21 Left 1143946651 17:10598574-10598596 CCCTTAGGGCTTCCTGACCCCAG No data
Right 1143946662 17:10598618-10598640 CAGCCTTCAAGGGTTCTAAGTGG No data
1143946652_1143946662 20 Left 1143946652 17:10598575-10598597 CCTTAGGGCTTCCTGACCCCAGG No data
Right 1143946662 17:10598618-10598640 CAGCCTTCAAGGGTTCTAAGTGG No data
1143946659_1143946662 2 Left 1143946659 17:10598593-10598615 CCAGGTTGAGAGCTTCTGGGCTG No data
Right 1143946662 17:10598618-10598640 CAGCCTTCAAGGGTTCTAAGTGG No data
1143946654_1143946662 9 Left 1143946654 17:10598586-10598608 CCTGACCCCAGGTTGAGAGCTTC No data
Right 1143946662 17:10598618-10598640 CAGCCTTCAAGGGTTCTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143946662 Original CRISPR CAGCCTTCAAGGGTTCTAAG TGG Intergenic
No off target data available for this crispr