ID: 1143947426

View in Genome Browser
Species Human (GRCh38)
Location 17:10605466-10605488
Sequence TTGGAGAAAGAGAAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143947419_1143947426 13 Left 1143947419 17:10605430-10605452 CCTAGAGGGGAGTGACATGGACA No data
Right 1143947426 17:10605466-10605488 TTGGAGAAAGAGAAGGAGGAGGG No data
1143947418_1143947426 14 Left 1143947418 17:10605429-10605451 CCCTAGAGGGGAGTGACATGGAC No data
Right 1143947426 17:10605466-10605488 TTGGAGAAAGAGAAGGAGGAGGG No data
1143947416_1143947426 21 Left 1143947416 17:10605422-10605444 CCAGTTACCCTAGAGGGGAGTGA No data
Right 1143947426 17:10605466-10605488 TTGGAGAAAGAGAAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143947426 Original CRISPR TTGGAGAAAGAGAAGGAGGA GGG Intergenic
No off target data available for this crispr