ID: 1143951210

View in Genome Browser
Species Human (GRCh38)
Location 17:10633903-10633925
Sequence GCATTAACACACATGTGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143951209_1143951210 6 Left 1143951209 17:10633874-10633896 CCGTCAGATGGTGAACACTTTCT 0: 1
1: 0
2: 0
3: 15
4: 178
Right 1143951210 17:10633903-10633925 GCATTAACACACATGTGTGCAGG 0: 1
1: 0
2: 0
3: 11
4: 118
1143951208_1143951210 7 Left 1143951208 17:10633873-10633895 CCCGTCAGATGGTGAACACTTTC 0: 1
1: 0
2: 1
3: 9
4: 116
Right 1143951210 17:10633903-10633925 GCATTAACACACATGTGTGCAGG 0: 1
1: 0
2: 0
3: 11
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143951210 Original CRISPR GCATTAACACACATGTGTGC AGG Intronic
900566792 1:3337219-3337241 GCATACACGCACATGTGTGTTGG + Intronic
900985008 1:6068279-6068301 GCATGCACACACGTGCGTGCTGG + Intronic
902853195 1:19178005-19178027 GCATTAACACGCCTGTGTTAAGG - Intronic
905114648 1:35627357-35627379 GCATAAAAACACAAGTGGGCTGG + Intronic
907653493 1:56319186-56319208 TCCTTAACACAGGTGTGTGCTGG + Intergenic
908473389 1:64467101-64467123 ACATTTACCCACATGTGTACTGG - Intergenic
915921972 1:159982712-159982734 GCATACACACACATGTGTGTAGG + Intergenic
916000824 1:160613621-160613643 GCATTAAAACACATGTGGTGTGG - Intronic
916003311 1:160636751-160636773 ACATTTACACACATTTGTGTAGG - Intronic
918796493 1:188904426-188904448 TCATTATCCCACAAGTGTGCTGG - Intergenic
921075238 1:211695266-211695288 GCACAAACACACATGTGCACAGG - Intergenic
923190338 1:231614277-231614299 GCATTAATCCCCATGTGTGGTGG + Intronic
923526531 1:234777083-234777105 CCATTAACCACCATGTGTGCTGG - Intergenic
924597560 1:245460766-245460788 GTGTAAGCACACATGTGTGCAGG - Intronic
1062868197 10:875667-875689 GCATTTCCTCACATGTGTGATGG - Intronic
1063142571 10:3268421-3268443 AAATAAACACACATGTGTTCTGG + Intergenic
1064066607 10:12187525-12187547 GAATTAACAACCATGTGTGTGGG - Intronic
1064787297 10:18912217-18912239 GCAGTAACACAGTTGTGTTCGGG - Intergenic
1069879065 10:71580455-71580477 CCCTTAAGACACATCTGTGCTGG - Intronic
1070982612 10:80661686-80661708 GCTGTAATTCACATGTGTGCTGG - Intergenic
1073598458 10:104823116-104823138 GCAGTAACAAACATGCCTGCAGG + Intronic
1076263859 10:129093808-129093830 CCCTGAACACACAGGTGTGCTGG + Intergenic
1083241009 11:61388668-61388690 GCATGAATACACCTGTATGCTGG - Intergenic
1084482802 11:69431649-69431671 ACACTCACACACATGTATGCAGG + Intergenic
1084495443 11:69500693-69500715 GCCTTGACACACACGTGTGCAGG - Intergenic
1085411005 11:76290559-76290581 GCATTTGTACACAAGTGTGCGGG - Intergenic
1090029980 11:123197869-123197891 GCATGAAGACAGATGTGTGTGGG + Intergenic
1090327209 11:125899444-125899466 GCTTTTACCCACATCTGTGCAGG + Exonic
1092118143 12:6024151-6024173 ACACAAACACACATATGTGCTGG + Intronic
1093925136 12:24902465-24902487 GCATTAAAACAAATGTCTGCAGG - Intronic
1094740079 12:33279081-33279103 ATATTAACCCACATGTCTGCTGG - Intergenic
1103850153 12:123927882-123927904 GGCTTAAAACACATGAGTGCTGG - Exonic
1106293377 13:28387497-28387519 GAATTAACAGACATTTCTGCTGG + Intronic
1109067159 13:57711226-57711248 GCATTCACATACATTTGAGCAGG - Intronic
1111265073 13:85799692-85799714 GTGTTTGCACACATGTGTGCAGG + Intergenic
1114382039 14:22216802-22216824 GCATTTTCTCACATGTTTGCTGG - Intergenic
1116243570 14:42379200-42379222 GCACACACACACATGTGCGCTGG - Intergenic
1117506825 14:56412777-56412799 GCATTAACAAATAAGTCTGCTGG - Intergenic
1118756918 14:68851694-68851716 GCATTCAAACCCAAGTGTGCTGG + Intergenic
1119139103 14:72249115-72249137 GCATTATCTCCCATGTGTACAGG - Intronic
1121337017 14:93083727-93083749 CCATCAACACACATGGGTGACGG - Intronic
1121504217 14:94464013-94464035 TCAGTAACCCATATGTGTGCAGG + Intronic
1124400738 15:29345514-29345536 GCATCAACTCTCCTGTGTGCAGG - Intronic
1129970614 15:79774861-79774883 GCAAGGACACACATGTGTGATGG + Intergenic
1132089557 15:98936816-98936838 GCACTAACACCCAGGGGTGCTGG - Intronic
1132882640 16:2169307-2169329 GAACAAACACACCTGTGTGCCGG + Intronic
1134053977 16:11157620-11157642 GCATTCACTGACATGTGGGCAGG - Intronic
1134662291 16:15993261-15993283 GGATTAACACAGATAAGTGCAGG - Intronic
1138765479 16:59597481-59597503 GTATTAACAAACATGTGGACAGG - Intergenic
1140986597 16:80163798-80163820 ACATACACACACACGTGTGCTGG + Intergenic
1141318555 16:82984963-82984985 GCATGAAGACACAGGTGTTCTGG - Intronic
1141787845 16:86213630-86213652 AAATAAACACACATGTGTGCTGG + Intergenic
1142259119 16:89034241-89034263 GCATTCACACACACATGTGTGGG + Intergenic
1143951210 17:10633903-10633925 GCATTAACACACATGTGTGCAGG + Intronic
1146425120 17:32731195-32731217 ACATTAAGACACATGGGGGCTGG - Intronic
1146838509 17:36132701-36132723 ACATTACCACCCATGTGAGCTGG + Intergenic
1151448013 17:74179844-74179866 GCCATGTCACACATGTGTGCAGG - Intergenic
1155673533 18:28401767-28401789 GTATTAATACACATCTTTGCTGG + Intergenic
1156532991 18:37836024-37836046 GCATTTATACATATCTGTGCTGG + Intergenic
1159146329 18:64458450-64458472 TCATTGACAGACATTTGTGCTGG - Intergenic
1165156189 19:33790019-33790041 TTATAAACACACAGGTGTGCAGG - Intergenic
1166043500 19:40216685-40216707 GCACTTACACACATGAGTGCAGG - Intronic
1166758223 19:45207804-45207826 GCATACACACACATGTGCACAGG + Intronic
1168517587 19:57021314-57021336 GCATTTACACACGTGGGTGGCGG - Intergenic
930723323 2:54658617-54658639 GTTTTAACACAAATGTATGCAGG - Intronic
933981590 2:87555204-87555226 GGATAGACACACATGTGTGGTGG + Intergenic
935710163 2:105891367-105891389 GCATGCACACACATGTATCCAGG + Intronic
936312245 2:111395612-111395634 GGATAGACACACATGTGTGGTGG - Intergenic
936562342 2:113551867-113551889 GTACTCACACAAATGTGTGCCGG - Intergenic
937927992 2:127182659-127182681 GAAATGACACACAGGTGTGCAGG + Intergenic
947872907 2:233449669-233449691 GCATGGACACGCAGGTGTGCGGG - Intronic
1171320430 20:24239078-24239100 GCTTTAAAGCACATGTGAGCAGG - Intergenic
1175533423 20:59690245-59690267 GCACAAACACAGATGTTTGCTGG + Intronic
1175639142 20:60612417-60612439 AAATTGGCACACATGTGTGCAGG + Intergenic
1177600966 21:23313230-23313252 CCATTCTCACACATGTGTGAAGG + Intergenic
1180569576 22:16702568-16702590 ACACAAACACACATATGTGCTGG + Intergenic
1182285859 22:29246512-29246534 GCAAAAAGACACTTGTGTGCTGG + Intronic
1184913644 22:47552220-47552242 GCATTGACAGCCATGTGGGCTGG + Intergenic
950258979 3:11530140-11530162 GTATTATAACACATCTGTGCTGG - Intronic
954155062 3:48680851-48680873 GCAGTAAGAGACATGGGTGCTGG - Intronic
955209545 3:56928104-56928126 GTATTAACCAACATGTGTGCTGG + Intronic
958492798 3:94798842-94798864 TAACTAACACATATGTGTGCTGG - Intergenic
960050467 3:113234373-113234395 GCATGTGCACACATGTGTGTAGG + Intronic
962924212 3:139976840-139976862 GCATGTGCACACATGTGTGTTGG + Intronic
965353561 3:167645980-167646002 GTATTTACACACATGTGAGTAGG + Intronic
967511516 3:190318899-190318921 GCATGAATCCACATGTGTGTAGG - Intronic
970999116 4:22302710-22302732 GAATTAACACAATTGTGGGCTGG - Intergenic
971535499 4:27743672-27743694 GCATATACACACATGCGTACAGG - Intergenic
973048834 4:45569513-45569535 GACCTAAAACACATGTGTGCAGG - Intergenic
980952900 4:139399252-139399274 GCATTAACAGACTTGTTTGTTGG + Intronic
985788630 5:1913252-1913274 GCAGTAACACACATGTGCACAGG + Intergenic
988514025 5:31889720-31889742 GCATTAAGACACACGGGGGCCGG + Intronic
992523964 5:77587331-77587353 GTATAAACACACATTTCTGCTGG + Intronic
993658750 5:90603890-90603912 GCCTGCACACACGTGTGTGCAGG + Intronic
993658751 5:90603891-90603913 GCCTGCACACACGTGTGTGCAGG - Intronic
999994832 5:157082494-157082516 GCATTAAGACACTTATGGGCTGG + Intergenic
1000309757 5:160030939-160030961 GCATTCACACATATGTGAGCTGG - Intronic
1001670938 5:173473298-173473320 GCACTAACAGAAATCTGTGCCGG - Intergenic
1002416583 5:179123990-179124012 GCATTGCCACACATGGGTGCAGG + Intronic
1004757554 6:18629228-18629250 GCCTTGACACACATGTATGTGGG - Intergenic
1006440701 6:34051942-34051964 GCATTCACACCCAGGTCTGCAGG + Intronic
1007078033 6:39080214-39080236 ACATGAGCCCACATGTGTGCAGG - Intronic
1007741326 6:44011364-44011386 GGATTCAAACACATGTGTGCTGG - Intergenic
1014965902 6:127750098-127750120 GCATTATCACACCTCTGTGCAGG + Intronic
1015918074 6:138238470-138238492 ACAGCAACACACATGTCTGCAGG - Intronic
1017759161 6:157554943-157554965 GGATTGACACACAGGGGTGCAGG - Intronic
1019183311 6:170206682-170206704 ACATGCACACACATGTGTTCAGG - Intergenic
1022025244 7:26442242-26442264 GCATTTAAAAACATGTGTGTGGG + Intergenic
1025782212 7:64611837-64611859 GGATTACCTCACCTGTGTGCTGG - Intergenic
1027148759 7:75717297-75717319 GGAATAACAAAAATGTGTGCAGG + Intronic
1029271780 7:99381288-99381310 GGCTGAACATACATGTGTGCAGG + Intronic
1034952863 7:155312829-155312851 GCTTCATCACACGTGTGTGCTGG + Intergenic
1036062899 8:5345098-5345120 ACACATACACACATGTGTGCAGG + Intergenic
1036477691 8:9108485-9108507 GCATTAAAAAACATGTGACCCGG - Intronic
1039589529 8:38734938-38734960 GCAGACACACACAAGTGTGCTGG - Intronic
1040847758 8:51862230-51862252 GCATTAATAAACATGAGTGTGGG - Intronic
1046524080 8:115361596-115361618 GCCTTAACAAACATCTTTGCAGG - Intergenic
1047160700 8:122375625-122375647 GCCTCAACTCACATGTTTGCAGG + Intergenic
1047535293 8:125713731-125713753 TCATTAACACACAAGTGAACAGG - Intergenic
1047865963 8:129024404-129024426 GCATTAACTCAAATGTGCACAGG - Intergenic
1052185501 9:25589288-25589310 GCATGAATGCAAATGTGTGCAGG + Intergenic
1055230055 9:74052398-74052420 GAATGAACACACATGTCTGATGG + Intergenic
1060957458 9:127652921-127652943 CCACTAACACACATGTCAGCTGG - Intronic
1062565871 9:137163748-137163770 GCATGAAGACCCCTGTGTGCCGG - Exonic
1188817668 X:34735419-34735441 ACAGTAACAGACATGTGTACAGG + Intergenic
1199466655 X:148145524-148145546 GCATGAACACACGTGCATGCAGG - Intergenic
1200897221 Y:8388525-8388547 TCATAATCTCACATGTGTGCTGG + Intergenic
1202248185 Y:22841169-22841191 GCATGATCACACATTGGTGCTGG - Intergenic
1202401173 Y:24474917-24474939 GCATGATCACACATTGGTGCTGG - Intergenic
1202469607 Y:25195169-25195191 GCATGATCACACATTGGTGCTGG + Intergenic