ID: 1143952181

View in Genome Browser
Species Human (GRCh38)
Location 17:10641969-10641991
Sequence CTGGTGTCCTTTAGGAAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 164}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143952178_1143952181 1 Left 1143952178 17:10641945-10641967 CCACTGGGAGCGTGAGGTCTATT 0: 1
1: 0
2: 0
3: 2
4: 61
Right 1143952181 17:10641969-10641991 CTGGTGTCCTTTAGGAAAATTGG 0: 1
1: 0
2: 1
3: 18
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143952181 Original CRISPR CTGGTGTCCTTTAGGAAAAT TGG Intronic
900906729 1:5564579-5564601 CTGGGGAGCTTTAGGAAAACTGG + Intergenic
903079892 1:20801572-20801594 CTGGTTTCTTCTAGGAGAATGGG - Intergenic
904221447 1:28973301-28973323 CTGGTGTCCTTGGGGATATTGGG + Intronic
906335827 1:44929928-44929950 CTGTTCTGCTTTAGCAAAATAGG + Intronic
908265091 1:62370786-62370808 CTGGTGTTCCTTAGGTAAAGAGG + Intergenic
909762194 1:79304101-79304123 CTGGTGTCCTATAAGAGCATAGG + Intergenic
911161872 1:94689379-94689401 CTGGAGCCCTTTAGAAAAATGGG + Intergenic
912937412 1:114015579-114015601 CTGTTTTCCTTGAGGCAAATAGG - Intergenic
913126838 1:115798806-115798828 CTGTTTTCCTTTAGGAATAAAGG - Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917391038 1:174537435-174537457 GGGGTGTTCCTTAGGAAAATAGG - Intronic
918295669 1:183154065-183154087 CTGGTGTTCTATAGCACAATAGG - Intergenic
918497138 1:185153520-185153542 CTGGTGACCTTTAAGAAAACAGG + Intronic
920021067 1:202957436-202957458 CTGGTGCTCTTTGGGAGAATGGG - Intronic
921190448 1:212703712-212703734 CTTCTCTCTTTTAGGAAAATTGG + Intergenic
921621750 1:217333123-217333145 CTGGTGTCTTTGTGGAAACTGGG + Intergenic
922679283 1:227578353-227578375 CTGGTGTCCCTGAAGGAAATGGG - Intronic
923835029 1:237601506-237601528 CTGGTGTCCTATTGGACAGTAGG + Intronic
924858814 1:247900318-247900340 CTTGTGTCCTTTAGGCCACTTGG - Intergenic
1065638019 10:27751288-27751310 CTGGTGTCCTTTTTAAAAAGAGG - Intergenic
1067975570 10:51021506-51021528 GTGCTGTCTTTTAGAAAAATGGG - Intronic
1071661842 10:87512026-87512048 CTGTTTTCCTAAAGGAAAATGGG - Intronic
1072571119 10:96658294-96658316 CTGGTTTCCTGGAAGAAAATTGG + Intronic
1075189249 10:120291280-120291302 CTGGTGACCTTAAAGAAAAATGG + Intergenic
1075829996 10:125400482-125400504 CTGGTGCCTTCAAGGAAAATGGG - Intergenic
1078724134 11:13913439-13913461 CTGGTCTCCTTGAGAGAAATTGG - Intergenic
1083764330 11:64834877-64834899 CTGGAGTCCTTGAGGAACGTAGG - Exonic
1084837094 11:71810551-71810573 CTGGTGTCCTGTAGAAGAATGGG + Intergenic
1085429232 11:76432654-76432676 TTGGTTTCCCTTAGGAAAATTGG - Intergenic
1085499114 11:77002068-77002090 CTGGTGTCCTTTATCAGAAAAGG - Intronic
1086356051 11:86000974-86000996 CAGGTGTTCATTAGGTAAATGGG - Intronic
1087294469 11:96354511-96354533 CAGGTGTATTTTAAGAAAATCGG + Intronic
1088775462 11:113078284-113078306 CTCGTGTCCTTAAAGAAAAGGGG - Intronic
1089884280 11:121804352-121804374 CTGTTCCCCTTTAAGAAAATAGG - Intergenic
1090655237 11:128838188-128838210 CTGGTCCCTTTTAGGAAGATGGG + Intronic
1091934563 12:4424813-4424835 CTTGTGTGCTTTAGAAGAATCGG + Intergenic
1092402135 12:8185554-8185576 CTGGTGTCCTGTAGAAGAATGGG - Intronic
1093484700 12:19640516-19640538 CTTGTGTCATTAAGAAAAATGGG + Intronic
1093519434 12:20031204-20031226 ATGATGTCGTTTAGAAAAATTGG + Intergenic
1093759650 12:22893743-22893765 CTGGTTTCCTTTAAGACCATGGG - Intergenic
1097289216 12:57899836-57899858 CTGGTGTCCTCTAGGTAGAAGGG - Intergenic
1098849973 12:75584463-75584485 AAGGTGACCTCTAGGAAAATGGG + Intergenic
1101620145 12:106378400-106378422 ATGGTGTCCTTAAGCAATATTGG + Intronic
1101660572 12:106761593-106761615 CTCATGTTCATTAGGAAAATGGG - Exonic
1102037379 12:109779708-109779730 CTTGTGTCCTTGAGGAAAGCTGG + Intergenic
1105510340 13:21046738-21046760 GTGGTGTCTTTTAGGAAAATTGG - Intronic
1105682008 13:22737732-22737754 CTGGTGTTCATTAGCACAATAGG + Intergenic
1105823991 13:24105823-24105845 CTGGTGTCTCTTAAGAAATTAGG + Intronic
1106076656 13:26466239-26466261 CTTGTATCCTTTGGGCAAATTGG + Intergenic
1106235284 13:27856199-27856221 CAGGTGGCCCTTAGGAAGATGGG + Intergenic
1107165516 13:37278278-37278300 CTGGTGTTCTTTTGCACAATAGG - Intergenic
1107550642 13:41471538-41471560 TTTATGTCCTTTAGGAATATAGG - Intergenic
1111960493 13:94804735-94804757 CTGGTGCCCTTTAGTAACATAGG + Intergenic
1112848694 13:103676450-103676472 ATGGTTTCCTTCAGGAAAAGTGG - Intergenic
1114289998 14:21280087-21280109 CTGGTGTCCTTTAGTACTCTAGG - Intergenic
1116038134 14:39653932-39653954 CTACAGTCCATTAGGAAAATGGG + Intergenic
1118512704 14:66493073-66493095 CTCGTGTCCTTTTTGAAAAATGG - Intergenic
1120964874 14:90158322-90158344 CTGGTGTCCATCAGGGAAAGAGG + Intronic
1123904301 15:24906885-24906907 CTGCTGTCCCTTAGGAGAAGAGG + Intronic
1125244809 15:37622794-37622816 CTGCTATTCTTTAGGTAAATGGG + Intergenic
1126765682 15:52008812-52008834 CTGGTGTCCTGGAAGAAAAATGG - Intronic
1127204875 15:56705162-56705184 TTGATGGCATTTAGGAAAATGGG - Intronic
1127685732 15:61341803-61341825 CTGGTGGAATTTAGGAGAATAGG - Intergenic
1128287912 15:66453689-66453711 CTTCTGTCCTTGAGGAAAAGTGG + Intronic
1133734987 16:8608038-8608060 ATGGTTCCCTTAAGGAAAATTGG - Intergenic
1143726194 17:8848289-8848311 ATGCTGTCTTTTAGGAAAAGAGG - Intronic
1143952181 17:10641969-10641991 CTGGTGTCCTTTAGGAAAATTGG + Intronic
1144511642 17:15882071-15882093 TTCGTGTCCTTAAGGAAAAGGGG + Intergenic
1144647220 17:16983371-16983393 GTGGTGTCATTTAGTGAAATGGG - Intergenic
1145216631 17:21057415-21057437 CAGGTGGCCTTCAGGGAAATGGG + Intergenic
1145234735 17:21200562-21200584 CTTGTGTCCTTTAGTCAGATGGG - Intronic
1148467986 17:47876315-47876337 CTGGCTTCATGTAGGAAAATAGG + Intergenic
1149972828 17:61236225-61236247 GTGGTGTTCTGTAGGAAAGTGGG + Intronic
1150011240 17:61506121-61506143 CTGGTATCCTTGAGGAAAGGGGG - Intergenic
1150220460 17:63493186-63493208 CTGGAGTCATTCAGGAAAATGGG + Intronic
1150356170 17:64486730-64486752 ATGGTGTGCTTTAGGGAAAGGGG + Intronic
1153352975 18:4102174-4102196 CTGGAGTCCTTTAGAACAGTTGG - Intronic
1153590701 18:6671527-6671549 CTTGTGTCCTCAAGTAAAATTGG + Intergenic
1153922454 18:9803875-9803897 GTTGTGTCCTGTAAGAAAATAGG + Intronic
1156844342 18:41646773-41646795 CTGCTGTCCTTCCAGAAAATCGG + Intergenic
1157606547 18:48929645-48929667 GTTTTGTCCTTTTGGAAAATTGG - Intronic
1158509993 18:58081870-58081892 ATGGTGTCATTGAGGTAAATAGG - Intronic
1163044977 19:14634528-14634550 GTGGTGTGATTTAGGATAATAGG + Intronic
1167800671 19:51739333-51739355 CTGGTGTCCTTATGAAAAAAGGG - Intergenic
926489825 2:13511601-13511623 ATGGTGTCCTGTTGGAATATGGG + Intergenic
928712004 2:34017814-34017836 CTGGTGTCCATTATGAAGTTTGG - Intergenic
930037388 2:47095291-47095313 CTGGTGTCCTTTATTAAAAGGGG + Intronic
931774246 2:65526468-65526490 CTGTTGTCCTTTGGGAACAATGG + Intergenic
936724445 2:115296101-115296123 CTGGTGAGCCTTAGGAAAAATGG + Intronic
941979979 2:171444729-171444751 TGGCTGTCCTTTAGGAAAAACGG + Intronic
942634300 2:177986185-177986207 CTGGAGACCTTCAGGAAAGTGGG + Intronic
945878151 2:215299684-215299706 CTGGTGTCCTTATGAGAAATGGG - Intergenic
946316007 2:218913020-218913042 CTGGTGTCTTTTATAAAAATGGG + Intergenic
946488299 2:220122169-220122191 TTGGTATCCAGTAGGAAAATAGG + Intergenic
948295061 2:236854463-236854485 CTGGTGTGGTGTAGGAAACTGGG + Intergenic
1169972255 20:11280568-11280590 CTGTTTTTCTTTAGGAACATTGG + Intergenic
1172772689 20:37390901-37390923 CTTGGGTCCTTCAGTAAAATTGG + Intronic
1176246468 20:64099583-64099605 CTGGTCTCCTGAAGGGAAATGGG - Exonic
1176905317 21:14493373-14493395 CTATTGTCCTTGGGGAAAATGGG - Intronic
1177935362 21:27338529-27338551 CTGATGTCCTTCAGAAAAAAAGG + Intergenic
1181429044 22:22866549-22866571 CTGATGTCATTCATGAAAATTGG + Intronic
1181879112 22:25963495-25963517 CTGGTGTCCTTGAGGACACATGG - Intronic
1183247926 22:36708269-36708291 CTGGTGTCCATTACTAAGATGGG + Intergenic
949220156 3:1623188-1623210 CTGGACTGCTTTAGGAAAACAGG + Intergenic
954456207 3:50601109-50601131 CTGGTGACCTTGAGGGAAGTAGG - Intergenic
955328696 3:58029379-58029401 ATGGTGTTCTTTGGGATAATGGG + Intronic
955544411 3:60012639-60012661 CTGGTTTCCTTTATCAATATAGG + Intronic
957983936 3:87548135-87548157 CTGGTTTGCTTTAGGAATGTGGG + Intergenic
958435550 3:94091600-94091622 CTTGTATCTTTTAGGAAAGTTGG + Intronic
959176459 3:102918712-102918734 ATGTTATCCTTTAGGAATATTGG + Intergenic
961613703 3:128161938-128161960 TTGGTGTCCTTGAGGAATTTGGG + Intronic
964225952 3:154402202-154402224 CTGATGTCCTTAAAGCAAATGGG + Intronic
964966712 3:162503220-162503242 CTGGTGTTCATCAGGAATATTGG - Intergenic
965044437 3:163557490-163557512 CTGGTGGCCTTAAGAAAAACGGG - Intergenic
965378733 3:167960789-167960811 ATGGTGAACTTTAGGAGAATCGG - Intergenic
967800769 3:193656724-193656746 GTGGTGTCATGTAGGAATATGGG + Intronic
969778506 4:9378046-9378068 CTGGTGTCTTGTAGAAGAATGGG + Intergenic
969856106 4:10001110-10001132 CTGGTGTCCTTTATAGAAAGAGG + Intronic
970086179 4:12348775-12348797 CTTGTGGCCTTTGGGAAGATGGG + Intergenic
970920882 4:21393461-21393483 GTGGTGGCCTTTCTGAAAATGGG - Intronic
971752816 4:30673117-30673139 TTGCTATTCTTTAGGAAAATTGG - Intergenic
972054119 4:34778748-34778770 CAGGTGGCCTTTAGGAATTTTGG - Intergenic
972097194 4:35363357-35363379 TTGGTGTTCTTGAGGAAAAAGGG - Intergenic
972309848 4:37870101-37870123 CATTTGTCCTCTAGGAAAATGGG - Intergenic
974671056 4:65030776-65030798 GTGGTGACATTTAGGAAGATTGG + Intergenic
974908800 4:68089766-68089788 CTGATCTCCTTTAATAAAATAGG - Intronic
976825529 4:89256431-89256453 CAGGTGTCTGTTATGAAAATAGG - Intronic
977211835 4:94227187-94227209 CTGGTGTTTTTGAGGAAAGTGGG + Intronic
977684676 4:99834956-99834978 CTGGTGTCCTCTTGTAAAAAGGG - Intronic
981514603 4:145593746-145593768 CTGATGTTCATTAGGGAAATTGG + Intergenic
981726573 4:147853520-147853542 CTGGTACCCTATAGAAAAATGGG + Intronic
983111738 4:163758584-163758606 CTTCTGTCCTTCAGGGAAATTGG - Intronic
984025262 4:174535734-174535756 CTGGTGTCCTTTTGCATAATAGG + Intergenic
984171157 4:176360918-176360940 CTGCTGTACTTTAGGAGAAAGGG - Intergenic
991455830 5:66803094-66803116 GGGGTGTCCATTAGTAAAATAGG + Intronic
993279041 5:85901421-85901443 CTGGTGTCATTTTTAAAAATTGG - Intergenic
998024032 5:138798060-138798082 CCTCTGTCCTTTAGGAAACTTGG + Intronic
1004402293 6:15299893-15299915 CCACTGTCCCTTAGGAAAATGGG + Intronic
1005462180 6:26079725-26079747 CTTGTGTCATTTAGGCAACTTGG + Intergenic
1006016473 6:31085369-31085391 CTGTTCTCTTTTAGGAAGATGGG + Intergenic
1008660431 6:53662207-53662229 CTGCTGTCATTTAGGAAAAATGG - Intronic
1008688699 6:53952967-53952989 TTGGTGTCCCTTAGTAAATTGGG - Intronic
1009850867 6:69196550-69196572 CTGGTGTCCTTATAGAAAAAAGG - Intronic
1010760390 6:79715947-79715969 CTTTTGTCATTCAGGAAAATAGG - Intergenic
1021548400 7:21842387-21842409 CTGCTGTACTTTAGGAAATTTGG + Intronic
1024827588 7:53410082-53410104 ATGCTGTCCTTGAAGAAAATAGG - Intergenic
1025012870 7:55412563-55412585 CTGGGGTACTATAGGAAAATTGG + Intronic
1027942202 7:84696974-84696996 CTGGTATCCTCTATGAAAACAGG + Intergenic
1028417209 7:90594150-90594172 CTGATCTCATTTAAGAAAATTGG + Intronic
1028646094 7:93098239-93098261 CTGGTGTTCTTTGGAAAAGTGGG + Intergenic
1028912245 7:96221798-96221820 TTGGTGTGCTTTGGGAAAATGGG - Intronic
1030195828 7:106852599-106852621 CTGGTATCCTCTAAGAAAACAGG - Intergenic
1034267244 7:149787161-149787183 TTGGTGTTAGTTAGGAAAATAGG + Intergenic
1034695671 7:153051137-153051159 CTGGTGTCCAGTAAGGAAATGGG + Intergenic
1034731609 7:153392035-153392057 CTTGTGTACTTAAGGAACATGGG + Intergenic
1036275950 8:7352043-7352065 TTGGTGTCCTGTAGAAGAATGGG + Intergenic
1036345405 8:7958324-7958346 CTGGTGTCCTGTAGAAGAATGGG - Intergenic
1036840733 8:12119070-12119092 TTGGTGTCCTGTAGAAGAATGGG - Intergenic
1036862537 8:12365328-12365350 CTGGTGTCCTGTAGAAGAATGGG - Intergenic
1038321576 8:26531944-26531966 TTGGTGTCCTTTGGGAAGACAGG + Intronic
1041023855 8:53664622-53664644 CTGGTGTCCTATTGTACAATAGG + Intergenic
1043341124 8:79240952-79240974 ATGGTGTTATTTATGAAAATGGG + Intergenic
1043910861 8:85862245-85862267 CTGGTGTCCTATTGCACAATAGG + Intergenic
1044079949 8:87871237-87871259 TTGGTGTCATTTACTAAAATGGG - Exonic
1045218923 8:100178035-100178057 GTGATGTCCTCTAGGAGAATTGG + Intronic
1045404259 8:101849560-101849582 CTGGTTTCCTATCGGAAAAATGG - Intronic
1048525614 8:135199712-135199734 CTGCTCTTCTTTAGGAAATTAGG - Intergenic
1050393482 9:5171050-5171072 TTGGTGTACTTCAGGAATATTGG - Intronic
1053278292 9:36799656-36799678 CTGGAGTCCTTGAGGACAGTGGG + Intergenic
1055048707 9:71958128-71958150 CTGGTGTTGTTTGGGGAAATAGG + Intronic
1055713123 9:79087213-79087235 CAGGTATCCTATCGGAAAATTGG + Intergenic
1058493657 9:105530275-105530297 AGGGTGTCCTTTAGGGAAGTGGG + Intronic
1062089249 9:134666294-134666316 CTGGTGTCACTTAGTAAACTGGG + Intronic
1185503345 X:615385-615407 CTGGTGTCTTTGGGGAAAAAGGG - Intergenic
1187146295 X:16640320-16640342 ATGGTTTCATTTAGGAAAAGAGG - Intronic
1188330485 X:28865091-28865113 CTGGTGTCATTTACTAAGATGGG + Intronic
1191157405 X:57288679-57288701 CTGATGTCCTTTAAGAAAAATGG + Intronic
1193756126 X:85410609-85410631 CTGGTGTCCTATTGCACAATAGG - Intergenic
1193898774 X:87149037-87149059 TTTGTGTTCTTTATGAAAATGGG + Intergenic
1195448926 X:104987560-104987582 TTTGTGTCCTTTAGCAAAGTAGG + Intronic
1197484009 X:127024494-127024516 CTGGTATCCTTGAGAAGAATGGG - Intergenic
1198437796 X:136634334-136634356 CTGATGTTGTTTAGGATAATTGG + Intergenic
1198605796 X:138335417-138335439 CTTGTGTCCATTAGGAAACTTGG - Intergenic
1198920863 X:141724930-141724952 CTGATGTCCTTTGGGAGAAATGG - Intergenic