ID: 1143959682

View in Genome Browser
Species Human (GRCh38)
Location 17:10705713-10705735
Sequence TTAAATGCCTATTTTAGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 888
Summary {0: 1, 1: 1, 2: 7, 3: 102, 4: 777}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143959680_1143959682 29 Left 1143959680 17:10705661-10705683 CCTTCTCACATGGATTGGTTACA 0: 1
1: 0
2: 0
3: 16
4: 139
Right 1143959682 17:10705713-10705735 TTAAATGCCTATTTTAGGCCAGG 0: 1
1: 1
2: 7
3: 102
4: 777

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143959682 Original CRISPR TTAAATGCCTATTTTAGGCC AGG Intronic
900850373 1:5137745-5137767 TTAAATGTTTATTGTAGGTCAGG - Intergenic
902107339 1:14048698-14048720 TTAAATAAGTATTTTAGGCCAGG - Intergenic
903040731 1:20528211-20528233 TTAAATGCCTATTCAGTGCCAGG + Intergenic
903146988 1:21380297-21380319 TAAAATGCAAATATTAGGCCAGG - Intergenic
903270247 1:22183688-22183710 TTAAATGCCCATTTGGGGCCAGG - Intergenic
903310966 1:22455559-22455581 TTAAATTGCTATTTTAGGTTTGG + Intronic
903422810 1:23230824-23230846 TTAAAAGCATTTTTTGGGCCGGG - Intergenic
903858075 1:26348849-26348871 TTAAAAACTTTTTTTAGGCCGGG - Intronic
904016682 1:27426931-27426953 TTGATTGCCTACTTTATGCCAGG - Intronic
904022361 1:27477242-27477264 TTAAATGTCTTTTTAAGGCCAGG + Intronic
904040353 1:27580717-27580739 TTAAATGCTTATTATGTGCCAGG - Intronic
904737995 1:32649957-32649979 AAAAATGATTATTTTAGGCCGGG - Intronic
904850708 1:33457178-33457200 TAAAATGACTGTTATAGGCCAGG - Intergenic
905126903 1:35721841-35721863 TTTAAAGCCTATATTGGGCCTGG + Intronic
905151736 1:35933345-35933367 TTAAATCCATAATTTAGGCTGGG + Intronic
905408134 1:37751269-37751291 TTAAATGATTATTTTCAGCCTGG + Intronic
905444243 1:38014929-38014951 ATAAATAACTATTTAAGGCCAGG - Intronic
905444770 1:38019777-38019799 ATAAATAATTATTTTAGGCCAGG - Intronic
906930220 1:50162417-50162439 TTAAATACCTACTGTAGGCCAGG + Intronic
907170829 1:52462651-52462673 TTAAAGGCTTATTTTGTGCCAGG - Intronic
907322500 1:53614095-53614117 TTGAATGCCTACTATATGCCAGG + Intronic
907537814 1:55180884-55180906 TTAAATACCTACTTTATGCTAGG - Intronic
907836336 1:58112354-58112376 TTGAATGCCTATTTTATACTTGG - Intronic
908008154 1:59748085-59748107 TTGAATGCCTATTTTACGCAAGG - Intronic
908041577 1:60119342-60119364 TTAAATGCCTAATATATGCCAGG + Intergenic
908201958 1:61806854-61806876 TTAAAAACATTTTTTAGGCCGGG + Intronic
908448188 1:64222252-64222274 TCATAGGCCTATTTTATGCCAGG - Intronic
908539944 1:65112713-65112735 TTGAGTGCCTACTTTATGCCAGG + Intergenic
908554115 1:65239952-65239974 GAAAATGACCATTTTAGGCCGGG - Intergenic
908590487 1:65626929-65626951 TAAAAAGCATATTTTAGGCAGGG - Intronic
908821066 1:68087118-68087140 TTAAGTGCGTATTATGGGCCAGG - Intergenic
908959088 1:69672576-69672598 TCAAATGCCTATTATATGCCAGG - Intronic
910794940 1:91088770-91088792 TTAAAAGCCTTATTTAGGCTGGG + Intergenic
910903158 1:92144510-92144532 TTAAAAGTATACTTTAGGCCTGG + Intronic
910951007 1:92648038-92648060 TAAAATGGTTATTTGAGGCCAGG - Intronic
911010454 1:93275402-93275424 TAAAATGTCTCTTTCAGGCCAGG - Intronic
911011192 1:93282582-93282604 TAAAATACATATTGTAGGCCGGG + Intergenic
911164276 1:94711340-94711362 TCGGATGCCTATTTTATGCCAGG + Intergenic
911218958 1:95227013-95227035 TTGAATGCCTTTTATATGCCAGG + Intronic
911405951 1:97439978-97440000 TTAGAAGTCTATTTTCGGCCGGG + Intronic
911504076 1:98726891-98726913 TTAAGTGCCTATTATGTGCCAGG - Intronic
912022788 1:105127190-105127212 TAAAATTTCTATTTTATGCCGGG + Intergenic
912120411 1:106464691-106464713 TAAAATGCATAATTAAGGCCAGG - Intergenic
912126467 1:106544969-106544991 TAAAATGCCTTTTTTGTGCCAGG - Intergenic
912187490 1:107295664-107295686 TTAAATGCCTACTATATCCCTGG - Intronic
912337039 1:108872847-108872869 TTAAATGCCTATTTTATGCCAGG - Intronic
912479920 1:109975178-109975200 TTAAAAGATTATTTTAGGCCGGG + Intergenic
912579752 1:110709440-110709462 TCAAATGCTTATCATAGGCCAGG - Intergenic
912753543 1:112305340-112305362 TTGAATACCTATTTTGTGCCAGG + Intergenic
912964189 1:114223041-114223063 CTGAGTTCCTATTTTAGGCCAGG - Intergenic
913023139 1:114807376-114807398 TTAAACAATTATTTTAGGCCAGG + Intergenic
913120110 1:115732208-115732230 TTAAGTGTCTATTATGGGCCAGG - Intronic
913303427 1:117398057-117398079 TTAAACACCTATTATATGCCAGG + Intronic
913378598 1:118184661-118184683 TTAAAGCCCTATTATGGGCCAGG + Intronic
913560033 1:120008784-120008806 GTAAATGCCTATTATGTGCCAGG + Intronic
914280618 1:146168203-146168225 GTAAATGCCTATTATGTGCCAGG + Intronic
914338383 1:146737721-146737743 TAAAATGCCTACTATAGGCCAGG - Intergenic
914541661 1:148619143-148619165 GTAAATGCCTATTATGTGCCAGG + Intronic
914624977 1:149452104-149452126 GTAAATGCCTATTATGTGCCAGG - Intergenic
914790989 1:150876965-150876987 TAAAATGGGTATTTTAGGCTGGG + Intergenic
915132504 1:153705456-153705478 TTAAATACCTAACATAGGCCAGG - Intergenic
916499608 1:165375646-165375668 TTATAAGTCTATTTTAGGCAAGG + Intergenic
916569900 1:166016123-166016145 TAAAAAGCCTATCTTAGGCTGGG + Intergenic
916602200 1:166304042-166304064 TAAAATGTCACTTTTAGGCCAGG - Intergenic
916762361 1:167828664-167828686 TTAAAATAATATTTTAGGCCAGG + Intronic
916971609 1:170025556-170025578 TTAAGTACCTATTGTATGCCAGG + Intronic
917090319 1:171346642-171346664 TTAAAAGTTTATTTTCGGCCAGG - Intergenic
917495571 1:175537374-175537396 TTAAATGGCTCTTGTAGGGCAGG + Intronic
917543504 1:175938075-175938097 TAAAAAGTCAATTTTAGGCCGGG - Intergenic
917703318 1:177603351-177603373 CTTAATACCTGTTTTAGGCCAGG - Intergenic
917801149 1:178571792-178571814 TAAAATGTCTAGTTTGGGCCAGG - Intergenic
917988125 1:180342472-180342494 TTAAGTGCCTATTGTATGCTAGG - Intronic
918148058 1:181775206-181775228 TTTAATGACTAGTTGAGGCCTGG + Intronic
918504660 1:185238731-185238753 TTAAATGCCTATTATCTGCCCGG - Intronic
918518211 1:185385840-185385862 TTGAATGCTTATTATGGGCCAGG + Intergenic
918569005 1:185965259-185965281 GTAAATGCAAATTTTAGGCTTGG + Intronic
918920775 1:190707022-190707044 TGAAATTCCTTTTTTAGGCTGGG - Intergenic
920092178 1:203462591-203462613 TTAAATGGCTATTATGTGCCAGG - Intergenic
920354778 1:205363448-205363470 TTAAAAGCTTATTATAGGCTGGG - Intergenic
920395184 1:205640095-205640117 CTAAGTCCCTATTTTATGCCAGG - Intergenic
920837691 1:209526943-209526965 TTAAGAGCCTATTTTATGCCAGG + Intergenic
921056576 1:211547101-211547123 TTAAATACCTCCTCTAGGCCAGG + Intergenic
921098569 1:211909021-211909043 TTAAGTGCCTACTTTATGCCAGG - Intergenic
921143379 1:212327719-212327741 TTGAGTGCCTATTATATGCCAGG + Intronic
921205108 1:212842080-212842102 TTAAAAGTCCATTTTAGGCTGGG + Intronic
921318235 1:213912418-213912440 TTGATTCCCTATTTTATGCCAGG - Intergenic
921330765 1:214033300-214033322 ATAAATGCCTATAATTGGCCAGG + Intronic
921418099 1:214913870-214913892 TTAAATGCCTATTTGTAACCAGG - Intergenic
921532104 1:216297054-216297076 TTCATTGCATCTTTTAGGCCTGG + Intronic
921576125 1:216837112-216837134 TTAAATACAACTTTTAGGCCGGG + Intronic
921780150 1:219153341-219153363 TTAAATGCCTGCTATATGCCAGG + Intergenic
922027703 1:221767085-221767107 TTTTATGCTTATTTTGGGCCAGG + Intergenic
922487230 1:225983697-225983719 AAGAATGCGTATTTTAGGCCAGG - Exonic
922866619 1:228866110-228866132 TTAAAGGCCACTTTTAGGGCAGG + Intergenic
922939671 1:229451101-229451123 AAAAATGCATATTTTAGGCACGG + Intronic
923170968 1:231416660-231416682 TTAAAAGATTATTTTAGGCTGGG - Intronic
923217579 1:231863524-231863546 TTAAAAGAATGTTTTAGGCCAGG - Intronic
923722159 1:236476389-236476411 AAAAATGTATATTTTAGGCCAGG + Intronic
923999173 1:239531952-239531974 TTAAATATCCATTCTAGGCCAGG - Intronic
924445568 1:244127204-244127226 TTAAACACCTATTATATGCCAGG + Intergenic
1062789762 10:295264-295286 TTAGATGGCTATTATTGGCCGGG + Intronic
1063830048 10:9942298-9942320 TTAAATACCTATGGTGGGCCAGG - Intergenic
1063876674 10:10485779-10485801 TTTCATGCCTATTTTAGGAACGG - Intergenic
1064181814 10:13123383-13123405 TTGAATGCCTATTGTATGTCAGG + Intronic
1064548772 10:16477470-16477492 TTAAATGTATATTTTAGGCTGGG - Intronic
1065073248 10:22049677-22049699 TTAAATGCCTACTCTATGCCAGG + Intergenic
1065358768 10:24869367-24869389 TTAAATGCCCATTACAGCCCTGG - Intronic
1065780344 10:29161109-29161131 TAAAATATATATTTTAGGCCTGG + Intergenic
1065856273 10:29832770-29832792 TAAAAAGCCCATTTTGGGCCAGG - Intergenic
1066188028 10:33029668-33029690 TAAAATTCCTGTTCTAGGCCAGG - Intergenic
1066331737 10:34431060-34431082 TTAAGTGACCATTTTAGCCCAGG + Intronic
1066400631 10:35072661-35072683 TTAAAAGCCCATTCTGGGCCAGG - Intronic
1066406328 10:35122528-35122550 TTTAATGCTTATTTTGTGCCAGG + Intergenic
1066412563 10:35187798-35187820 TAAAATTCCCATTTAAGGCCAGG - Intronic
1066460999 10:35612108-35612130 TTAAATGCCTCTTACAGGGCAGG - Intergenic
1068067684 10:52152254-52152276 TTAAATTTCTATTACAGGCCAGG + Intronic
1068528355 10:58156803-58156825 CTAAATGCTTATGTTAGGCAGGG - Intergenic
1069105748 10:64381389-64381411 TTAAATGGTGATTTTTGGCCAGG - Intergenic
1069305854 10:66968719-66968741 TTAAATACATATTTTTGGCCGGG + Intronic
1069491503 10:68865352-68865374 TTAAAGGCCAGTTTTTGGCCGGG + Intronic
1069498138 10:68925586-68925608 TTAAATGTCCAGTATAGGCCAGG + Intronic
1069672837 10:70224113-70224135 ATAACTGTCTATTTCAGGCCAGG + Intronic
1069971789 10:72177101-72177123 TTAAATGTCTACTTTATACCAGG - Intronic
1070614395 10:77958330-77958352 TTAAAAATCTATTTTAGGTCAGG - Intergenic
1071530755 10:86389071-86389093 TTAAAAACCTATTTGTGGCCAGG + Intergenic
1072038672 10:91587472-91587494 TTAAGTGCCTACTTTTTGCCAGG + Intergenic
1072143795 10:92615106-92615128 TTAAAAAGCTTTTTTAGGCCAGG + Intronic
1072950323 10:99841255-99841277 TAAAATGCAGATTTTTGGCCAGG + Intronic
1073264675 10:102218812-102218834 TAAAATGTATATTTTAGGCCAGG - Intergenic
1073350662 10:102817448-102817470 TTAAATGCCATGTTTTGGCCGGG - Intergenic
1073659440 10:105457960-105457982 TCAAGTGCCTATTTTATGCAAGG - Intergenic
1074001771 10:109380598-109380620 GTAAATGTCTATTTTGGGGCTGG - Intergenic
1074397606 10:113111354-113111376 TTCAGTGCCTATTTCATGCCTGG - Intronic
1074498178 10:113998170-113998192 TTCAATGTCTTTTTTTGGCCGGG + Intergenic
1074512722 10:114132309-114132331 ATAAATGCCTAATATATGCCAGG + Intronic
1075101330 10:119508293-119508315 TTAAAAGCAGATTTTGGGCCGGG - Intronic
1075987567 10:126800685-126800707 TAAAATATCCATTTTAGGCCGGG + Intergenic
1076054586 10:127361407-127361429 TTAAATAACTACTTTAGGCCGGG - Intronic
1077826736 11:5818561-5818583 ATAAATCCCTATTTTAGGAAAGG + Intronic
1077908202 11:6550836-6550858 TTAAATGTCTATTTTAGGTGTGG - Intronic
1078139489 11:8682055-8682077 CTAAATGCCACATTTAGGCCAGG - Intergenic
1078209598 11:9259731-9259753 TTAAGAGACTATTTCAGGCCAGG + Intronic
1078620824 11:12906244-12906266 TTAAATGTACAATTTAGGCCTGG + Intronic
1078790583 11:14538002-14538024 TTAAAAAGCAATTTTAGGCCAGG - Intronic
1078915623 11:15775721-15775743 TTAAATGCCTCTTATGTGCCAGG + Intergenic
1079041777 11:17066022-17066044 ATAAATCAGTATTTTAGGCCAGG + Intergenic
1079048428 11:17130507-17130529 TAAAAACACTATTTTAGGCCGGG + Intronic
1079118038 11:17653131-17653153 TTAAATGCCTACCATAGGCCAGG - Intergenic
1079376303 11:19895044-19895066 TTAAGTGCATATTATATGCCAGG + Intronic
1079446939 11:20566207-20566229 TTAAAAACGTATTTTAGGCCAGG + Intergenic
1079858532 11:25637474-25637496 TTATTTGCCTATTGTAGGCTTGG - Intergenic
1080311730 11:30901694-30901716 TTAAATTCTTATTTAAAGCCTGG - Intronic
1080612982 11:33921055-33921077 TTAAATGCTTATCTTATGGCAGG - Intergenic
1080947612 11:36992616-36992638 TTGAATGCCTATTTTATTCTAGG + Intergenic
1081202289 11:40231530-40231552 TTAAATGCATATTTTGTGCCAGG + Intronic
1081436856 11:43036294-43036316 TTGAATGCCTACTATGGGCCAGG + Intergenic
1081547478 11:44081613-44081635 TCAAGTGCCTATTATATGCCAGG - Intronic
1081622965 11:44629925-44629947 TTAAATGCTCATTATATGCCAGG - Intergenic
1081920378 11:46769779-46769801 TCAAGTACCTATTTTATGCCAGG - Intronic
1081990639 11:47335620-47335642 TTAAAAACATATTTAAGGCCAGG - Intronic
1082278921 11:50248786-50248808 TTAAAATCTTCTTTTAGGCCAGG + Intergenic
1083030707 11:59589300-59589322 TTAAATGTATCTTTTTGGCCAGG + Intronic
1083050274 11:59770697-59770719 TTAAATTTCTATTATATGCCTGG + Intronic
1083433673 11:62628506-62628528 TAAAATCCCTTTTTGAGGCCGGG - Intronic
1083556198 11:63630499-63630521 TTAAAGGGCTATTTTTGGGCTGG + Intronic
1083841484 11:65307256-65307278 TTAAATTACTTTTTGAGGCCGGG - Intergenic
1084075981 11:66776752-66776774 TGAAATGCTTTTTCTAGGCCAGG + Intronic
1085427550 11:76418104-76418126 TAAAATGGCTTTTATAGGCCAGG + Intergenic
1085569027 11:77543058-77543080 TTAAAAGAGTATTTCAGGCCGGG - Intronic
1086460260 11:86998907-86998929 TAAAAAGCCTATTCTAGGCGGGG - Intergenic
1086596375 11:88576439-88576461 TTAACTGCCTATTGTGTGCCAGG - Intronic
1086798424 11:91138922-91138944 TTAAAAACTTATGTTAGGCCAGG + Intergenic
1087226122 11:95601007-95601029 TTGAATTCCTACTTTAGGCCAGG - Intergenic
1087510197 11:99082476-99082498 TTAAATATCTGTTTTTGGCCTGG - Intronic
1087773794 11:102239428-102239450 TCAAATGCCCATTATATGCCAGG + Intergenic
1088056898 11:105593706-105593728 TTAAATGCATATTTAAGGAGTGG - Intergenic
1088556175 11:111063598-111063620 TTGAATGCCCACTTTGGGCCAGG + Intergenic
1088906238 11:114157450-114157472 TTAAATGCCAACTGTATGCCAGG - Intronic
1089056619 11:115590870-115590892 TTGAATGCCTATTTTATGCCCGG - Intergenic
1090353082 11:126120256-126120278 TTGAGTGCCTATTATATGCCAGG + Intergenic
1090377651 11:126302656-126302678 ATAAAAGACTACTTTAGGCCAGG - Intronic
1090687411 11:129138966-129138988 TTATATGCCTGTTTTAGACATGG - Intronic
1091102000 11:132883304-132883326 TTAAATCATTATTTTAGGTCAGG + Intronic
1091859560 12:3768082-3768104 TTAAATGTGTGTTCTAGGCCGGG + Intergenic
1092823783 12:12378074-12378096 TTTAAAGTCTATTATAGGCCGGG + Intronic
1092831425 12:12448013-12448035 CAAAATGCCTATTCTAGACCTGG - Intronic
1093319060 12:17689715-17689737 GTAAAAACCTACTTTAGGCCGGG - Intergenic
1093552248 12:20427908-20427930 TTAAAATAATATTTTAGGCCGGG + Intronic
1093552332 12:20428574-20428596 TTAAAATAATATTTTAGGCCGGG - Intronic
1093961140 12:25273957-25273979 TTAAAAATCTTTTTTAGGCCGGG - Intergenic
1094226761 12:28054655-28054677 TTGAGTGCCTACTATAGGCCTGG - Intergenic
1094371058 12:29737863-29737885 TGGAATGCCTATTGTAAGCCAGG - Intronic
1094570076 12:31633843-31633865 TTAAAAGTTTATTTTTGGCCGGG + Intergenic
1094637969 12:32245380-32245402 TCAAGTGACTATTTGAGGCCTGG + Intronic
1094770722 12:33655503-33655525 TTAAAATATTATTTTAGGCCAGG + Intergenic
1095839842 12:46681082-46681104 TTAAATGCCTCCTATATGCCAGG - Intergenic
1096165758 12:49422587-49422609 TTGAATGCTTACTATAGGCCAGG - Intronic
1096321390 12:50617037-50617059 TTAAATGTAAATTTTAGACCAGG - Intronic
1096562067 12:52442866-52442888 GTAGATGCCTAGTTTAGGCGAGG + Intergenic
1096831628 12:54318969-54318991 TTAAATGTCAATTGTGGGCCAGG - Intronic
1097298059 12:57988771-57988793 TTAAGCACCTATTTTATGCCAGG + Intergenic
1097431007 12:59506778-59506800 TTAAAAAGCTATTTTGGGCCAGG - Intergenic
1097527586 12:60757234-60757256 TTAACTGCCTAATTTAGGCCAGG - Intergenic
1097959576 12:65519338-65519360 TTAGATGCCTGTTTTATGCTAGG + Intergenic
1097960098 12:65523933-65523955 TTAGATGCCTGTTTTATGCCAGG + Intergenic
1097987023 12:65794564-65794586 ATAAAAACATATTTTAGGCCGGG + Intergenic
1098760111 12:74412983-74413005 TTAAATGCTTATTTTAAATCAGG - Intergenic
1099104253 12:78480128-78480150 TTAAAGGCCTAATTAAGGACAGG + Intergenic
1099141030 12:78975399-78975421 CTAAATGCCTAGTCTATGCCAGG - Intronic
1099214797 12:79840280-79840302 TTAAATGCTTATTATATGCCAGG - Intronic
1099465896 12:82987752-82987774 TTAAATGCCTAAATAAGGCAGGG + Intronic
1100002942 12:89859276-89859298 TTAAATGCATATTTTGTGCTAGG + Intergenic
1100366659 12:93927645-93927667 TTAAAAGCCTACTATAGACCGGG + Intergenic
1100583479 12:95957755-95957777 ATAAATTCCGTTTTTAGGCCAGG + Intronic
1100818769 12:98411448-98411470 GTCAATGCATATTTTATGCCAGG - Intergenic
1101381840 12:104220426-104220448 TAAAAAGTGTATTTTAGGCCAGG + Intronic
1101424777 12:104578956-104578978 TTGAGGGCCTATTTTGGGCCTGG + Intronic
1101682388 12:106981814-106981836 TAAAATCCATTTTTTAGGCCAGG - Intronic
1101690307 12:107073392-107073414 TAAAAAGTATATTTTAGGCCAGG - Intronic
1101838058 12:108308833-108308855 TTAAATACCTATTATGAGCCAGG + Intronic
1102371837 12:112388339-112388361 TTAAATGCCTACTCTGTGCCAGG + Intergenic
1102479256 12:113209828-113209850 TTAAAAGACTATTTCAGGCCAGG + Intronic
1102509273 12:113403294-113403316 TTAAATTCTTTTTTTAGGTCAGG + Intronic
1103439812 12:120954809-120954831 TTAAATTCCCATTTTAGGCTGGG - Intergenic
1103756327 12:123210395-123210417 TAAAATACATATTTTTGGCCAGG + Intronic
1103777104 12:123374281-123374303 TAAAATACCTAAATTAGGCCAGG + Intergenic
1104873848 12:132019335-132019357 TCAAAAGCCATTTTTAGGCCGGG - Intronic
1105310583 13:19205106-19205128 TTAAAAGCCTACTGTAGGCCAGG - Intergenic
1105731007 13:23215565-23215587 TTAAATGCTCAGTTTAAGCCTGG + Intronic
1105770491 13:23607136-23607158 TTAAATGTATAGTTTGGGCCAGG + Intronic
1106386358 13:29289758-29289780 TGAAATGCCTACTTTGGGCCAGG - Intronic
1107176580 13:37406554-37406576 TAAAATGTCTACTTTGGGCCAGG + Intergenic
1107896604 13:44970969-44970991 TTAAAAACCTATTATGGGCCGGG - Intronic
1109715922 13:66222077-66222099 TTGATTGCCTATTTTATGCAAGG + Intergenic
1109750196 13:66681850-66681872 TGAAATGCCTAGTCTATGCCAGG - Intronic
1109936396 13:69291317-69291339 TTAAATGTATATTTTAGGTTGGG - Intergenic
1110007156 13:70287535-70287557 TTAAAAACATATATTAGGCCGGG + Intergenic
1110251811 13:73388677-73388699 TTAAATGCCTATTATAAACTAGG - Intergenic
1110273403 13:73616366-73616388 TTAAATTCTTACTTTGGGCCAGG + Intergenic
1110608500 13:77461659-77461681 TTAAATGCCTACTTTATGCTAGG + Intergenic
1111367423 13:87267964-87267986 TTAAAATCCAATATTAGGCCAGG - Intergenic
1112024456 13:95399529-95399551 TTAAAAACATATTTTGGGCCAGG + Intergenic
1112735732 13:102414370-102414392 TTAAATGGCCATTTTTGGTCTGG - Intergenic
1113381408 13:109809421-109809443 TTACATGTCTATTTTAGGAGTGG + Intergenic
1114447605 14:22801409-22801431 CTAAATGCCTAGGTTAGGACTGG + Intronic
1114620137 14:24090926-24090948 TTAAGTGCCTGTTATAGGCCAGG + Intronic
1115194521 14:30781744-30781766 TTGAAAGCTTATTTTATGCCAGG - Intergenic
1115198093 14:30823554-30823576 TTAAAAGCATATTTAAGACCAGG + Intergenic
1115326455 14:32144777-32144799 CTAAATGGAAATTTTAGGCCAGG - Intronic
1115522561 14:34247397-34247419 TTAAATGACTATATTGGGTCGGG - Intronic
1115582216 14:34772247-34772269 TAAAATGATCATTTTAGGCCAGG - Intronic
1116616973 14:47152396-47152418 TTGAATACCTATTTTGGGCCAGG + Intronic
1116726642 14:48569522-48569544 TTTAATGCCTGCTTTATGCCAGG + Intergenic
1117421379 14:55549327-55549349 TTAAAAGTTTATTTAAGGCCAGG - Intergenic
1117813939 14:59577895-59577917 TTAAATGCTTATTTTGTTCCAGG + Intergenic
1117863769 14:60122764-60122786 TTAAAGGCCTATTCTGTGCCAGG - Intronic
1118082971 14:62382871-62382893 TTAAATGCCTAATATGGGCCAGG + Intergenic
1118203841 14:63703357-63703379 TTAAAGACCTAATTAAGGCCAGG + Intronic
1118488890 14:66240069-66240091 TTAAATACCTACTGTAGGACCGG + Intergenic
1118626225 14:67661858-67661880 TTAAAAACAGATTTTAGGCCAGG + Intronic
1118656583 14:67956986-67957008 TTAAATGCCTACCATATGCCAGG + Intronic
1118747282 14:68783278-68783300 TTAAGTGCCTATAATGGGCCAGG + Intergenic
1118759719 14:68872799-68872821 TTAAATGCCTACTGTGTGCCAGG + Intergenic
1118968224 14:70608160-70608182 TTAAAAGAAGATTTTAGGCCGGG + Intergenic
1119369939 14:74130879-74130901 TTAAAAGCCTATTTAGGGCCGGG - Intronic
1119522544 14:75296548-75296570 TTCAAAGCCTAATTCAGGCCAGG + Intergenic
1119943099 14:78662165-78662187 TTAAAAGCTTATTCTGGGCCTGG - Intronic
1120245465 14:82000908-82000930 TAAAATGCCTATTTTAGGCTGGG + Intergenic
1120356142 14:83436489-83436511 TTAAATGCCTATGGTGTGCCAGG + Intergenic
1120728878 14:87979320-87979342 TGAAATGCCTGTTGCAGGCCAGG - Intronic
1120979280 14:90276512-90276534 TTAAAAGCCCATTTGAGGCCAGG - Exonic
1120980496 14:90284981-90285003 AGAAATGTCGATTTTAGGCCGGG + Intronic
1121096033 14:91218696-91218718 AAAAATCCCCATTTTAGGCCAGG - Intronic
1121250936 14:92498791-92498813 CAAAATGCCTTTTTTTGGCCAGG - Exonic
1121728559 14:96170628-96170650 TTAAATGCCTACTATGAGCCAGG - Intergenic
1121768390 14:96507568-96507590 TTAAAAAACTATTTTCGGCCAGG - Intronic
1121953401 14:98192451-98192473 TTAAATACCTACTCTATGCCAGG + Intergenic
1122450285 14:101800264-101800286 TTAAATCGTTACTTTAGGCCAGG + Intronic
1124129604 15:26972020-26972042 CTAACTGCCTAGTTTAGACCGGG + Intronic
1124840911 15:33241300-33241322 TTAAAAGCCTCTTTTTGGCCAGG - Intergenic
1125010189 15:34863636-34863658 TTGAGTACCTATTATAGGCCAGG - Intronic
1125069659 15:35537935-35537957 TTGAATGCCTACTATATGCCTGG - Intronic
1125211786 15:37225469-37225491 TGAAATGCCTATTATGTGCCCGG + Intergenic
1125245142 15:37627903-37627925 TTAAAAACCTATTTTATGTCAGG + Intergenic
1125497735 15:40213086-40213108 TTAAGTACCTATTTTGGGCCAGG + Intronic
1126682898 15:51220453-51220475 TTGATTGCTTATTTTATGCCAGG - Intronic
1126961872 15:54005541-54005563 TTTAATGTCTATTATATGCCAGG - Intergenic
1127062182 15:55197790-55197812 TCAAATGCCTATTATGTGCCAGG - Intergenic
1127511673 15:59648111-59648133 TTAAAAGCCTAGTTATGGCCGGG + Intronic
1127847001 15:62878725-62878747 TTAAATGCCTACTGTATGCCAGG + Intergenic
1127897148 15:63311265-63311287 TTAAATGCTTATATTAGGTAAGG + Intergenic
1127962990 15:63903697-63903719 TTAAAATTCAATTTTAGGCCAGG + Intergenic
1127992177 15:64128106-64128128 TTGAATGTATATTTTATGCCAGG + Intronic
1128177948 15:65573310-65573332 TTAAATTCTTATTAGAGGCCAGG + Intronic
1128191155 15:65699031-65699053 TAAAAAGGCTATCTTAGGCCTGG - Intronic
1128694992 15:69754925-69754947 TTGAATGTCTATTGTATGCCAGG + Intergenic
1128831108 15:70769703-70769725 TAAAATGTGTATTTTAGGCCAGG + Intergenic
1129378323 15:75149123-75149145 TTAAAAGCCTATGTGAGGCCAGG + Intergenic
1129546323 15:76399427-76399449 AGAAATGCCTATTTCTGGCCAGG - Intronic
1129614559 15:77087935-77087957 TTTAAAACCTATTTTGGGCCAGG - Intergenic
1130044531 15:80433592-80433614 TAAAATGCCTTTTCTAGGCTGGG - Intronic
1130095341 15:80851394-80851416 CTGAATCCCTATTCTAGGCCAGG + Intronic
1130225477 15:82054972-82054994 TGAAATACCTATATAAGGCCAGG + Intergenic
1131140187 15:89971089-89971111 ATAAGTGCCTATTATATGCCAGG + Intergenic
1131738033 15:95355782-95355804 TTAAAAACCTTTTTGAGGCCAGG + Intergenic
1132126814 15:99234665-99234687 TAAATTGCCCATTTTTGGCCAGG - Intronic
1132370175 15:101291174-101291196 TTAAATTTATATTGTAGGCCAGG - Intronic
1133266871 16:4590261-4590283 TTAAAAAACTATTTTTGGCCAGG + Intronic
1133520441 16:6550842-6550864 TTAAATATCTATTTAGGGCCAGG - Intronic
1133658396 16:7889750-7889772 TAAAGTGCCCATTATAGGCCAGG + Intergenic
1133749240 16:8711942-8711964 TGAAATTACTATTTTTGGCCAGG + Intronic
1134171157 16:11970827-11970849 GAAAATGCTGATTTTAGGCCAGG - Intronic
1134171207 16:11971150-11971172 GAAAATGCTGATTTTAGGCCAGG - Intronic
1134302239 16:13002138-13002160 TAAAATGCCTATGATATGCCAGG + Intronic
1135013950 16:18908068-18908090 TTAAATGCCAAACATAGGCCAGG + Intronic
1135340319 16:21640231-21640253 TAAAGTGTCTCTTTTAGGCCGGG - Exonic
1135543220 16:23348354-23348376 TTGAATGCCTACTATATGCCAGG - Intronic
1135582279 16:23638991-23639013 TTAAATGCCTACTGTGTGCCTGG - Intronic
1135844486 16:25906434-25906456 TTAAATGCTTATTACATGCCTGG + Intronic
1136074994 16:27810981-27811003 TTAAAAGACTTTTTTGGGCCGGG - Intronic
1136340258 16:29638378-29638400 TTAAATCACTTTGTTAGGCCAGG + Intergenic
1136420151 16:30126968-30126990 ATAAATAACTATTTCAGGCCAGG - Intergenic
1136425532 16:30167604-30167626 TTCAATACCTAGTTCAGGCCAGG + Intergenic
1136445758 16:30317111-30317133 TTAAATGCCAAACATAGGCCAGG + Intergenic
1137307433 16:47216945-47216967 TTAAATGAATAATTCAGGCCAGG - Intronic
1137769026 16:51001038-51001060 TTGAATACCTAATTTAAGCCAGG + Intergenic
1137968201 16:52957856-52957878 AGAAATACTTATTTTAGGCCAGG + Intergenic
1138171167 16:54850899-54850921 TAAAATGAACATTTTAGGCCAGG - Intergenic
1138266316 16:55662366-55662388 CTAAATGCCTATCATATGCCAGG + Intronic
1138682943 16:58699529-58699551 TTTAAAGCTTATTTTAGGGCCGG + Intergenic
1138795636 16:59965084-59965106 TTAAAAGCCTATTTTAAGAATGG - Intergenic
1139995895 16:70979633-70979655 TAAAATGCCTACTATAGGCCAGG + Intronic
1140100536 16:71912530-71912552 ATAAAAGAATATTTTAGGCCGGG - Intronic
1141233121 16:82189524-82189546 TTAAATGCTAATTGTAGGGCAGG - Intergenic
1141504923 16:84470357-84470379 TTAAATGCCTTTTGAAGGCCAGG + Intergenic
1142716469 17:1749693-1749715 TAAAATGCCTAAATAAGGCCAGG - Intronic
1143009213 17:3856737-3856759 TTAAAAAATTATTTTAGGCCGGG - Intergenic
1143198853 17:5098050-5098072 TTAAATAGTTATATTAGGCCTGG - Intergenic
1143342426 17:6223604-6223626 TTAAAAGGTTATTTAAGGCCGGG + Intergenic
1143855583 17:9845531-9845553 TCAAATGCCTATTGTGTGCCAGG - Intronic
1143959682 17:10705713-10705735 TTAAATGCCTATTTTAGGCCAGG + Intronic
1144272657 17:13633335-13633357 TTAAAGTCCTATTTCATGCCGGG - Intergenic
1144606925 17:16674971-16674993 TGAAATGGATTTTTTAGGCCGGG + Intergenic
1144888602 17:18480373-18480395 TTAAATGCATAATTTTGGCATGG - Intronic
1145143605 17:20463925-20463947 TTAAATGCATAATTTTGGCATGG + Intronic
1146205463 17:30901385-30901407 TTGAATGCCTACTTTGGGCAAGG - Intronic
1146999108 17:37347605-37347627 TAAAATAACTATTTTAGGCCAGG + Intronic
1147024548 17:37569112-37569134 TTAAATAGCTAATTTAGGCTGGG + Intronic
1147392325 17:40117766-40117788 TTAAATGCCTACTTTGTGGCAGG + Intergenic
1147617366 17:41837445-41837467 TTAAATTTCTTTCTTAGGCCGGG - Intronic
1147634376 17:41954280-41954302 TTAAATACATATGTCAGGCCGGG - Intronic
1147682703 17:42261993-42262015 GTAAAAATCTATTTTAGGCCAGG - Intronic
1149435172 17:56627909-56627931 ATAAATGCATTTGTTAGGCCTGG + Intergenic
1149648834 17:58263441-58263463 TAAATTTTCTATTTTAGGCCAGG + Intronic
1149769936 17:59312551-59312573 TTAATAGACCATTTTAGGCCAGG - Intergenic
1149923836 17:60682815-60682837 TCAAAATACTATTTTAGGCCAGG - Intronic
1150118199 17:62574323-62574345 TTAAATGCTTATTTTATGCTAGG + Exonic
1150129720 17:62661950-62661972 TTAAAAGATTATTCTAGGCCAGG + Intronic
1150263580 17:63816963-63816985 TGAAATGCTTATTTCAGACCTGG - Exonic
1151095161 17:71489159-71489181 ATAACTGCCTATTTTAGGAGAGG - Intergenic
1152226689 17:79096081-79096103 TTACCTGCCCATTTGAGGCCAGG - Intronic
1152332731 17:79682602-79682624 TTAAAAACCTATTCAAGGCCAGG + Intergenic
1152771502 17:82172363-82172385 TTAAAAACCTGTTTTAGACCTGG - Intronic
1153052473 18:912684-912706 TTAGATCCCTATTTTAGGCTGGG - Intergenic
1153178713 18:2408399-2408421 TTAAATGCCTACATTATGCATGG - Intergenic
1153261303 18:3226758-3226780 TTAAATGCCTGTTGTGGGTCAGG - Intergenic
1153898833 18:9596528-9596550 TTAAATGCTTACTTTGTGCCTGG - Intronic
1154142692 18:11839138-11839160 TTAAACACCTATTATATGCCAGG - Intronic
1155414794 18:25585718-25585740 TTAAATGTTTGTATTAGGCCAGG - Intergenic
1155471466 18:26196545-26196567 TTAAATGCATAGGTAAGGCCAGG + Intergenic
1155471673 18:26198401-26198423 TTAAATGCATAGGTAAGGCCAGG + Intergenic
1155681725 18:28494832-28494854 TTTATTACCTATTTTAGGCTGGG - Intergenic
1155769203 18:29674876-29674898 TTAAATACCTCTTTTAAGGCAGG - Intergenic
1156248875 18:35331670-35331692 TTAAATGCCTACTCTGGGTCAGG - Intergenic
1156278654 18:35610505-35610527 TTAAATGCCAGTTTTATGCTGGG - Intronic
1156311843 18:35930376-35930398 TTAAATTTTTGTTTTAGGCCAGG - Intergenic
1156440918 18:37186876-37186898 TTAAAAGCCTATCATTGGCCAGG + Intronic
1157329725 18:46694861-46694883 TTAAAAACCCTTTTTAGGCCGGG + Intronic
1157871960 18:51238157-51238179 TTAAAAAACTATTTTTGGCCTGG + Intergenic
1158238870 18:55353917-55353939 TTATAATCCTATTTAAGGCCAGG - Intronic
1158427044 18:57349684-57349706 TTAACTGCTTAATATAGGCCAGG + Intergenic
1158625273 18:59065987-59066009 TTGAATGCTTATTCTATGCCAGG + Intergenic
1158675609 18:59515331-59515353 TTAAATGCCTACTATGTGCCAGG + Intronic
1158859989 18:61582358-61582380 TTTCATCCCTATTTTAAGCCTGG - Intergenic
1158955308 18:62532514-62532536 CTAAAGGCCTATTAGAGGCCAGG - Intronic
1159065824 18:63567068-63567090 TCAAATGCCCATCTTATGCCAGG - Intergenic
1159216185 18:65393514-65393536 TTAAAACATTATTTTAGGCCGGG - Intergenic
1161245654 19:3250191-3250213 TTAAATGCATGGTTCAGGCCGGG + Intronic
1161981119 19:7630912-7630934 TTAGATGAAAATTTTAGGCCAGG + Intronic
1162429684 19:10620597-10620619 TTAAATGTTTGTTTTATGCCAGG + Intronic
1162509462 19:11109085-11109107 GTAAAAGCCATTTTTAGGCCTGG + Intronic
1162533244 19:11247860-11247882 TTAAGTGCCAATTGTATGCCAGG - Intronic
1162712514 19:12606173-12606195 AAAAAATCCTATTTTAGGCCAGG - Intronic
1163260147 19:16184652-16184674 TTAAAAATCTATTTTATGCCGGG - Intergenic
1163787804 19:19285460-19285482 TAAAAAACCTATTTGAGGCCGGG - Intronic
1164141932 19:22477556-22477578 TTAAAAGCAAATTTTAGGCCGGG - Intronic
1164373155 19:27658877-27658899 TAAAATGCCTAGGTTCGGCCAGG + Intergenic
1164609116 19:29620418-29620440 TTAAATGCCGATGAGAGGCCAGG - Intergenic
1164964147 19:32466339-32466361 TTAAATGCCTATTTCTGTACTGG - Intronic
1165164767 19:33844317-33844339 TAAAATGCATAGTTCAGGCCGGG + Intergenic
1165428925 19:35760778-35760800 TAATATGCCCAATTTAGGCCTGG - Intronic
1166603614 19:44119921-44119943 TTAAAATACTATTCTAGGCCAGG + Intronic
1166994191 19:46711686-46711708 AAAAATTACTATTTTAGGCCGGG - Intronic
1167087203 19:47318587-47318609 TAATATGCCCATTTCAGGCCAGG - Intronic
1167756921 19:51418496-51418518 TTAAATTTGAATTTTAGGCCAGG - Intergenic
1167866611 19:52334217-52334239 TTAAATAACTAATTTAGGCCGGG + Intergenic
1167936742 19:52914971-52914993 TTTTATGCCTACTTTAGTCCTGG + Intergenic
1168141908 19:54393763-54393785 TTAAAAGACTATTTTTAGCCGGG + Intergenic
1168341522 19:55626012-55626034 TTAAAAATTTATTTTAGGCCGGG - Intergenic
1168487481 19:56776659-56776681 TTAAATGCCTGTTTTGTGCAAGG + Intronic
925796176 2:7545223-7545245 TTGAATGCCTACTTAATGCCGGG - Intergenic
926799089 2:16643199-16643221 TTGAATGCCTACTTCATGCCAGG - Intronic
926952807 2:18261788-18261810 TAAAATGCCCATTGTAGGCCGGG - Intronic
927105143 2:19817765-19817787 TTAAAACTCTATTTTGGGCCTGG - Intergenic
927545298 2:23947182-23947204 TAAAATGCTTACGTTAGGCCAGG - Intronic
928146770 2:28785514-28785536 TAAAATGCTGTTTTTAGGCCTGG + Intronic
928651248 2:33405830-33405852 TTAAATGCTTATTTTGTACCAGG + Intergenic
928734788 2:34275598-34275620 CTGGATGCCTACTTTAGGCCAGG - Intergenic
929199461 2:39219761-39219783 TAAAATGCCTATTCAAGGCAAGG + Intronic
929408687 2:41672096-41672118 TTAACTACCTATTCTATGCCAGG + Intergenic
929828795 2:45331052-45331074 TTAAGTGCCTGTAGTAGGCCAGG - Intergenic
929991125 2:46787887-46787909 TTAAAAGCTAATTTTAGGCCAGG + Intergenic
930199684 2:48541052-48541074 TTAAAAGTTTATTTTGGGCCGGG + Intronic
930659297 2:54037701-54037723 TTAAAAGCATGTTTTAGGCCGGG - Intronic
931458395 2:62429946-62429968 TTAAATTCAAATTATAGGCCTGG - Intergenic
931630580 2:64295027-64295049 TTAAGTGCCTATTGTGTGCCAGG - Intergenic
931672099 2:64656369-64656391 TTAAAAGCCCATTTAAGGGCTGG + Intronic
931733266 2:65171808-65171830 TTAAATGCATGTTTTAGGCTGGG + Intergenic
931958452 2:67454523-67454545 TTAAATGCCAATTTTTAGCATGG - Intergenic
932358048 2:71082832-71082854 TTAAGTGCCTATTATGTGCCAGG + Intergenic
932370389 2:71182405-71182427 TTAAGTGCCTATTATGTGCCAGG + Intergenic
932954101 2:76331443-76331465 ATAAATATATATTTTAGGCCAGG + Intergenic
933520631 2:83367774-83367796 TTAAAAGTCTACTTTAGGCCCGG - Intergenic
933789807 2:85874726-85874748 TTAAATGCCTTTTATATGCGAGG - Intronic
934935118 2:98459730-98459752 TTATATGCCTATTTTGTGCCAGG - Intronic
934959559 2:98658959-98658981 CTGAATGCCTACTCTAGGCCAGG + Intronic
934999917 2:99003150-99003172 TTTAAAGTCTGTTTTAGGCCAGG - Intronic
935072900 2:99711421-99711443 TTAGATGCCTATTTTGTACCAGG - Intronic
935751946 2:106243216-106243238 TTAATTGCCTATTATTGGTCTGG - Intergenic
935912357 2:107910763-107910785 TTAATTGCCTATTATTGGTCTGG - Intergenic
936479608 2:112873639-112873661 TTAAATAGTTATTTGAGGCCAGG - Intergenic
937385048 2:121421836-121421858 TTATATACTTATTTTAGGCCGGG - Intronic
938041002 2:128076064-128076086 TAAAATGTAAATTTTAGGCCGGG - Intergenic
938801314 2:134765869-134765891 TTAAATACCTATTATATGCCAGG - Intergenic
938894076 2:135733634-135733656 TTGAATGCCTGTTTCAGGACAGG - Intergenic
938930521 2:136082637-136082659 TTAAATGCCTACCATACGCCAGG + Intergenic
939001443 2:136740221-136740243 TTAAAGGCTTCTTATAGGCCAGG - Intergenic
939417667 2:141922216-141922238 TTCAATACGTATTTTATGCCAGG - Intronic
939488087 2:142842205-142842227 TTAATTGCCTATTATATGCTTGG + Intergenic
939917551 2:148066017-148066039 TTAAATGCCATTGTTGGGCCAGG + Intronic
940527569 2:154836509-154836531 TTAAATGCCTATTTATGTCATGG + Intronic
940677707 2:156745457-156745479 TTAAATGCTTATTATGTGCCAGG + Intergenic
940740020 2:157496903-157496925 TTAAAAGCATATCCTAGGCCAGG + Intergenic
940818105 2:158319059-158319081 TTAAAAGGCTATTTTAGGTGAGG - Intronic
941382815 2:164816556-164816578 TAAAATTTCTAATTTAGGCCTGG - Intronic
942636808 2:178016291-178016313 TTAAATGCCATTATGAGGCCTGG + Intronic
942698583 2:178676807-178676829 TTAAATGCCTTTTTAACACCAGG - Intronic
943338296 2:186645671-186645693 TTAAAAGGCTGTTTAAGGCCGGG + Intronic
943613690 2:190066850-190066872 TTGAATGCCTATTTTGTACCTGG + Intronic
943702105 2:190997437-190997459 TTAAATGCCTACTGTGTGCCGGG - Intronic
943774826 2:191753943-191753965 CTAAATGCCTACTCTTGGCCAGG + Intergenic
943825766 2:192389090-192389112 TAAAATGTCTATCTTTGGCCAGG - Intergenic
943855926 2:192790592-192790614 TGAAATGACTATTTATGGCCTGG - Intergenic
944091317 2:195915046-195915068 TTAAATGCCTGCGTTATGCCAGG + Intronic
944756940 2:202772917-202772939 TTAAAAACCAATTATAGGCCGGG - Intergenic
944791764 2:203137686-203137708 TTAAATTCCATTTATAGGCCTGG + Intronic
944973875 2:205025145-205025167 ATTAATGCCGATTTTAGGTCGGG + Intronic
945095724 2:206217233-206217255 GTAAATGCCTTTCTTAGGGCTGG + Intronic
945278189 2:208009489-208009511 TCAAAAGCCTATTTTGTGCCAGG + Intronic
947460280 2:230298264-230298286 TGAGATGTCTGTTTTAGGCCGGG + Intronic
947470553 2:230397608-230397630 TGAGATGCCAATTTTAGGCAAGG + Intronic
947974821 2:234356677-234356699 TTAAATACTTATTATGGGCCAGG + Intergenic
948972028 2:241436202-241436224 TTAAATGTTTACTATAGGCCGGG - Intronic
1168742988 20:210575-210597 TAAAATGTCTATTCTTGGCCAGG - Intergenic
1168768774 20:400362-400384 CTGAATGCCTACTATAGGCCAGG + Intergenic
1168775889 20:447253-447275 AAAAATGCATATTTTGGGCCGGG - Intronic
1168883821 20:1229376-1229398 TTATATACTTATTTTATGCCAGG - Intronic
1169009907 20:2241908-2241930 TTGAATGCCTACTGTATGCCAGG + Intergenic
1169334220 20:4741834-4741856 TTAAAAGCATGTTTAAGGCCGGG - Intergenic
1170039272 20:12023160-12023182 TTAAATGCCTATTGCATGCAAGG + Intergenic
1170405150 20:16027972-16027994 TTAGATGCTTAATTGAGGCCTGG + Intronic
1170466106 20:16623718-16623740 TAAAATCACTATTATAGGCCCGG - Intergenic
1170620400 20:17990963-17990985 TTAAATGCCCATTACAGCCCTGG + Exonic
1170935849 20:20808714-20808736 ATAAATGCCTATTTGAGGCCAGG + Intergenic
1171979992 20:31620966-31620988 TAAAATTATTATTTTAGGCCGGG - Intergenic
1172070872 20:32255972-32255994 TTAAAAATCTATTTTAGGTCGGG + Intergenic
1172171124 20:32933681-32933703 TTAAAAACCTCTTTTTGGCCGGG + Intronic
1172224166 20:33293540-33293562 TTAAAACAGTATTTTAGGCCAGG + Intronic
1172505989 20:35463105-35463127 TTAAATGCCCAAATAAGGCCAGG + Intronic
1173220396 20:41127713-41127735 TTAAAGGAGTCTTTTAGGCCAGG + Intergenic
1174502893 20:50998753-50998775 TTAAATACATATTTGCGGCCAGG - Intergenic
1174912935 20:54625894-54625916 TTAAATGCCTACTATATGCCAGG + Intronic
1175369305 20:58476500-58476522 TTGAATGCCTGTTGTATGCCTGG + Intronic
1178746496 21:35255756-35255778 TTAAATGGCTATTTTTGACCAGG - Intronic
1181183457 22:21083643-21083665 TTAAATGGGTAGTCTAGGCCAGG - Intergenic
1183210995 22:36451153-36451175 TTAAATCCTTATTTGCGGCCAGG - Intergenic
1183901889 22:41012012-41012034 TTAAAAGACTTTTTAAGGCCGGG + Intergenic
1184008857 22:41731708-41731730 TTATATTCCTAGTTTATGCCAGG + Intronic
1184926430 22:47643124-47643146 TAAAATGTCTATTTGAGGCTGGG - Intergenic
1185252192 22:49809244-49809266 TAAAATTCCAGTTTTAGGCCAGG + Intronic
949195863 3:1306719-1306741 TTTAATGCCTATTATGGGTCAGG - Intronic
949582097 3:5398744-5398766 TTGAATGCCTGTTATATGCCAGG + Intergenic
950051669 3:9995955-9995977 TTAAGTGCCTATTCTGTGCCAGG + Intronic
950059000 3:10053722-10053744 TTAAGTGCCTATTCTGTGCCAGG + Intronic
950300597 3:11874392-11874414 TTAAGTGCCTATTCTGTGCCAGG + Intergenic
950768033 3:15288460-15288482 TTGAAAGGCTATTTCAGGCCGGG + Intronic
950878979 3:16306007-16306029 TGAAATACCTATTTTGTGCCTGG - Exonic
951467167 3:23014020-23014042 TTAAATGCTTGTTTTGTGCCAGG + Intergenic
951642924 3:24856043-24856065 GTAAATGCAGATTTCAGGCCAGG - Intergenic
952546315 3:34423516-34423538 TTAAATGCTTATCTTAGGGAAGG + Intergenic
953118877 3:40019626-40019648 TTAAGCTCCTATTTTATGCCTGG - Intronic
953585311 3:44195714-44195736 TTAAAAACCAATTATAGGCCGGG + Intergenic
954007996 3:47608380-47608402 TAAATTAGCTATTTTAGGCCGGG - Intronic
954817021 3:53290512-53290534 TTAGATGCCTTTCCTAGGCCAGG - Intronic
954834055 3:53449216-53449238 TTTAATGTCTATATTAGGCCGGG - Intergenic
954911329 3:54113250-54113272 TTAAATGCTGAATTTTGGCCAGG - Intergenic
955182486 3:56684829-56684851 TTAAAAACACATTTTAGGCCAGG + Intergenic
955227132 3:57069938-57069960 TTAAAAGTTTAGTTTAGGCCAGG - Intronic
955369296 3:58337380-58337402 TTAAATGCCTACTATGTGCCAGG + Intronic
955766079 3:62345729-62345751 TTTAATATGTATTTTAGGCCAGG - Intergenic
955829774 3:62988664-62988686 TCAAATGCCTATTGTGTGCCAGG - Intergenic
955987406 3:64588376-64588398 CTAAGTGCCTATTGTAGGCCAGG - Intronic
956123228 3:65987161-65987183 TAAAATCCCTTCTTTAGGCCAGG - Intronic
956202933 3:66726509-66726531 ATAAAAGCATATTGTAGGCCAGG + Intergenic
956523096 3:70127008-70127030 TTAAAAGCCTAATTTTGGCCAGG - Intergenic
956628585 3:71291514-71291536 TTAAATGCCTGCTGTATGCCAGG - Intronic
956911259 3:73820156-73820178 TAAAGTACCCATTTTAGGCCAGG - Intergenic
957121504 3:76100637-76100659 TTCAGTGCATATTTTATGCCAGG - Intronic
957166335 3:76678264-76678286 TTAAAAGCATATTTTCAGCCAGG - Intronic
957479427 3:80772445-80772467 TAAAAGCCTTATTTTAGGCCGGG + Intergenic
958042087 3:88238960-88238982 TAAAAAGCCAATTTTAGGCCAGG + Intergenic
958178191 3:90023475-90023497 TTAAAATCCTATTTTTGCCCAGG + Intergenic
958466649 3:94468309-94468331 TTAAATGAGTATTTCAAGCCTGG - Intergenic
958834458 3:99128207-99128229 TTAAATGGCTAATTTGGGCCGGG - Intergenic
959450307 3:106490742-106490764 TAAAATGCATATTTTATGCATGG + Intergenic
959479217 3:106850917-106850939 TGAAATGCCTATCTTAAGCTAGG + Intergenic
959951091 3:112181049-112181071 AAAAATGCAAATTTTAGGCCGGG - Intronic
959982810 3:112536624-112536646 TGAAATTACTATTTAAGGCCGGG + Intronic
960398123 3:117162221-117162243 TTAAATAGATTTTTTAGGCCGGG + Intergenic
960421059 3:117445872-117445894 TTAAGTGACTTTTTTAGACCTGG + Intergenic
960425181 3:117497985-117498007 TTAAATGCCTACTCTATACCAGG + Intergenic
960430238 3:117559966-117559988 TAAAATGCCTTTTCCAGGCCGGG - Intergenic
960555580 3:119025973-119025995 TAAGATGCCTATATTAGGCTGGG + Intronic
961750535 3:129091489-129091511 TAAAAAACCTTTTTTAGGCCGGG + Intronic
961774356 3:129273317-129273339 TTAAAAAGTTATTTTAGGCCGGG - Intronic
961846397 3:129767893-129767915 ATAAATACATATTTCAGGCCAGG + Intronic
961852301 3:129833281-129833303 TAAAAATCCTATCTTAGGCCAGG + Intronic
962083817 3:132169499-132169521 TTGAATGCCTAACTTGGGCCAGG + Intronic
962665339 3:137648621-137648643 TTAAAGGCCTACTGTATGCCAGG - Intergenic
963465661 3:145678324-145678346 TTCCATGCCTTTTCTAGGCCAGG - Intergenic
964069363 3:152612869-152612891 TTAAAAGACTATTTCTGGCCAGG - Intergenic
964078507 3:152722361-152722383 ATAACTGCCTACTTTATGCCAGG + Intergenic
964097255 3:152946606-152946628 ATAAAAACCTATTTTGGGCCAGG - Intergenic
964631511 3:158815442-158815464 CTATATGCCTATTTTAGGAAGGG - Intronic
964731962 3:159877051-159877073 ATACATCCCTATTTTAGGCTGGG + Intronic
965754378 3:172010470-172010492 TTGAATGCCTACTTCATGCCTGG - Intergenic
965866579 3:173212187-173212209 TTAAATTTTGATTTTAGGCCGGG + Intergenic
966522468 3:180888619-180888641 TTAAAAGCCAACCTTAGGCCAGG - Intronic
966568019 3:181404836-181404858 TTAAAAACACATTTTAGGCCGGG + Intergenic
966601542 3:181780220-181780242 TTAAAAGCATAGATTAGGCCTGG + Intergenic
966771771 3:183510577-183510599 TAAAAAGCATTTTTTAGGCCGGG + Intronic
966795708 3:183711524-183711546 ATAAATGACTATTTTTGGACAGG - Intronic
967269461 3:187720795-187720817 TTAAATGCTTAGCCTAGGCCGGG + Intronic
967451000 3:189622645-189622667 TTAAATGCCTATGGTATGCCTGG - Intergenic
967711552 3:192714068-192714090 TTGAATGCTTATTATATGCCAGG + Intronic
968174803 3:196540258-196540280 AAAAATCCTTATTTTAGGCCGGG + Intergenic
968342075 3:197964690-197964712 TTAAAAAACTTTTTTAGGCCGGG - Intronic
968920905 4:3521838-3521860 TGAAATAACTATTTTAGGCCGGG + Intronic
969146614 4:5129904-5129926 TTGAGTGCCTATTATATGCCAGG + Intronic
969784158 4:9440078-9440100 TTTAAGGCACATTTTAGGCCGGG + Intergenic
969847677 4:9932327-9932349 GTAAATGCCTACTGTATGCCAGG + Intronic
969987680 4:11228337-11228359 TTAAAAACCTATTTTGTGCCAGG + Intergenic
970158133 4:13162139-13162161 TTCAATGTCTATTTTACGTCTGG - Intergenic
970582433 4:17485781-17485803 TAAAATGGCTAATTTTGGCCGGG + Intronic
970867998 4:20781303-20781325 TTAAATCCCTACTGTAAGCCAGG + Intronic
971323973 4:25628979-25629001 TTAAATTCCATTTTTGGGCCAGG + Intergenic
971395372 4:26222196-26222218 TTAAAAGCACATTTCAGGCCGGG + Intronic
972069850 4:35004824-35004846 TTAAAAGTCTATTTACGGCCAGG + Intergenic
972442156 4:39105056-39105078 TTAAAAGTTTATTTTAGGCCAGG - Intronic
972763819 4:42132738-42132760 TAAAATTCCTAATTTAGGCTGGG - Intronic
972804681 4:42517003-42517025 TTAAAAACCTGATTTAGGCCAGG + Intronic
972922837 4:43965494-43965516 TAAAATTCCCATTTTCGGCCAGG + Intergenic
972992909 4:44844665-44844687 GAAAATGTCTATTTTCGGCCAGG + Intergenic
973146204 4:46830450-46830472 TAAAATGACTATTTTAGTCTGGG + Intronic
973737322 4:53885401-53885423 TTGAATGCCTACTATATGCCAGG - Intronic
974027660 4:56748144-56748166 TTAAAAGCGTATTTCAGGGCCGG + Intergenic
974101289 4:57420493-57420515 TTAAATGACTATCATATGCCAGG + Intergenic
974302797 4:60090978-60091000 TTAACTCCTTATTTGAGGCCAGG + Intergenic
974424615 4:61725315-61725337 TTAAATGTCTACTTAAGGCTGGG + Intronic
974477331 4:62400208-62400230 TTGAATGCCTACTATATGCCAGG - Intergenic
974609327 4:64195113-64195135 TAAAATGCCCATATTAGGCTGGG - Intergenic
974695338 4:65361185-65361207 TTGAAGGCCTACTTTATGCCAGG + Intronic
975238462 4:72029113-72029135 AGAAATACCTATGTTAGGCCGGG + Intergenic
975358404 4:73435815-73435837 TTAAATGCCTATCATATGCCAGG - Intronic
975586534 4:75955577-75955599 TTTAGTGCCAATTTTATGCCTGG - Intronic
975599441 4:76084010-76084032 TTAAATCCCTCTTTTACCCCAGG + Intronic
975785054 4:77878582-77878604 TAAAAATCTTATTTTAGGCCAGG + Intronic
976100080 4:81552158-81552180 ATACATGACTATTCTAGGCCTGG + Intronic
976493585 4:85699873-85699895 TTAAATGCCTACTATGGGCCAGG - Intronic
976629613 4:87222877-87222899 CTAAATACATATTGTAGGCCGGG - Intronic
977213962 4:94256698-94256720 TTAAGTGGCCAATTTAGGCCAGG - Intronic
977382120 4:96288541-96288563 ATAAATGCCTAGTATAGGCAGGG + Intergenic
977497282 4:97793184-97793206 TTAAATGACGATTTTAGGTAAGG - Intronic
977740551 4:100476011-100476033 CTAAATGCCTAGTGTATGCCAGG - Intronic
977797909 4:101191024-101191046 ATAAATGCCTGTTTAAGGCAAGG + Intronic
977902224 4:102435956-102435978 TAAAATGGCCATTATAGGCCGGG + Intergenic
978425276 4:108575958-108575980 TTAAATACCCATCTTAGGCTGGG + Intergenic
978444125 4:108764414-108764436 TTAATTCCAGATTTTAGGCCAGG + Intergenic
978497141 4:109372016-109372038 TTAAATGCTTACTCTATGCCAGG + Intergenic
979265422 4:118696401-118696423 TTAAAGGTGTATTTTAGGCCAGG - Intronic
979291878 4:118987371-118987393 TAAAATGCCTAATATGGGCCAGG + Intronic
979539028 4:121858099-121858121 TTAAAGGTTCATTTTAGGCCAGG - Intronic
979907033 4:126307251-126307273 TTAAATGAAAATTCTAGGCCAGG + Intergenic
980141284 4:128920577-128920599 TTAAAAGCCTTTTCTAGGCTGGG - Intronic
980174602 4:129329410-129329432 TTAAATACCTATTTTAGGGCTGG - Intergenic
980828136 4:138096434-138096456 TGAAATGCCTATTCAAGGCGAGG - Intergenic
983009907 4:162535095-162535117 ATAATTGCCTATTTTATGCTTGG + Intergenic
983224313 4:165071945-165071967 TTAAAAGACTCTTATAGGCCAGG + Intergenic
983340099 4:166449690-166449712 TTAAATTACTATTAAAGGCCAGG + Intergenic
983593079 4:169436197-169436219 TAAAATAACAATTTTAGGCCAGG - Intronic
983777672 4:171628593-171628615 GGAAATGTGTATTTTAGGCCGGG - Intergenic
983846165 4:172522374-172522396 TAAAAAGTGTATTTTAGGCCGGG + Intronic
983946795 4:173595126-173595148 TTAAATATATATTTTTGGCCGGG - Intergenic
984005599 4:174303073-174303095 TTAAAAGACTATTTGAGGCTGGG - Intronic
984258803 4:177419402-177419424 TTAAATTCCTATTGTATGCCAGG + Intergenic
984613855 4:181873362-181873384 TAAAATACTTATATTAGGCCGGG - Intergenic
985690467 5:1308306-1308328 TTCAAAACATATTTTAGGCCAGG - Intergenic
986475176 5:8122611-8122633 TTAAATTAGAATTTTAGGCCAGG + Intergenic
986833077 5:11603771-11603793 TTAAATACCTATTTTGTTCCAGG + Intronic
988304328 5:29475322-29475344 TAAAAGGCAAATTTTAGGCCAGG + Intergenic
988317372 5:29647542-29647564 TTAAAAGAATATTTTTGGCCGGG - Intergenic
988436744 5:31184414-31184436 TTGAGTGCCTATTATGGGCCAGG - Intergenic
988572336 5:32380943-32380965 AGAAATGCCTGTTTTGGGCCGGG - Intronic
989603545 5:43222431-43222453 TCAAAAGCCTACTTTGGGCCAGG + Intronic
990154130 5:52855470-52855492 TTGAATGCCTATTTTGTGCTTGG + Intronic
990174956 5:53097340-53097362 TTGAATGCCTGTTTTGTGCCAGG - Intronic
990373825 5:55149836-55149858 TTAAAAGGTTATTTTTGGCCAGG + Intronic
992844098 5:80727662-80727684 TTGAATGCCTATTATATGCCAGG + Intronic
993384487 5:87247766-87247788 TTAAATGCCTACTATAGGACAGG - Intergenic
993716188 5:91277937-91277959 CAAAATGCCTATTTTTGGCTGGG + Intergenic
994350579 5:98741977-98741999 TTGAGTACCTATTTTATGCCTGG - Intergenic
995200683 5:109422393-109422415 TAAAATGTATATTCTAGGCCGGG + Intergenic
995405198 5:111786926-111786948 TTAAGTACCTATTTAAGGTCAGG + Intronic
996040281 5:118801523-118801545 TAAAATGCTTACTTTATGCCAGG + Intergenic
996064626 5:119067407-119067429 CTAAATCCCTATTCTTGGCCGGG - Intronic
996138940 5:119880577-119880599 TTAAGTACCTTTTCTAGGCCAGG - Intergenic
996506808 5:124276864-124276886 CAAAATTCCTATTTTAGGCCAGG - Intergenic
996713308 5:126565097-126565119 TAAGATGTCTATTCTAGGCCTGG + Intronic
996972402 5:129387359-129387381 TTATATGCCTATTTTAGGAAGGG - Intergenic
997452771 5:133996680-133996702 TTGAATGCCTATTATGTGCCAGG - Intronic
997537920 5:134636901-134636923 TTAAGTACCTATTTTGTGCCAGG - Intronic
997699303 5:135885272-135885294 TTAAATGCCCATTGTATGCCTGG - Intronic
997859621 5:137404710-137404732 TTAAAATGTTATTTTAGGCCAGG - Intronic
998531346 5:142888075-142888097 TTGAATGCATATTTATGGCCTGG + Intronic
998726534 5:145023061-145023083 TTGAATGCCTACTTTATGACAGG + Intergenic
999138733 5:149342614-149342636 TAAAATGCCTTGTTTAGGCCAGG + Intergenic
999214420 5:149920030-149920052 TAAAGGGCCTAATTTAGGCCAGG + Intronic
999480964 5:151947955-151947977 TGAAAGGCCTATGTTAGGTCAGG + Intergenic
999495689 5:152094564-152094586 TTAAGTGCCCATTTTCTGCCAGG - Intergenic
1000718434 5:164676727-164676749 TTGAGTGCCTATTGTATGCCAGG - Intergenic
1001118628 5:168960362-168960384 TTAAATGCCTACTATATGCCAGG + Intronic
1001719247 5:173843061-173843083 TTAAAAACCAATTTTAGGCCAGG + Intergenic
1001903546 5:175451927-175451949 TTGAGTGCCTATTATTGGCCAGG + Intergenic
1002118979 5:176986922-176986944 TTAAAAAACTATTATAGGCCAGG + Intronic
1002366466 5:178716486-178716508 TTAAGTGCCTACTATGGGCCAGG + Intronic
1002589116 5:180276558-180276580 TTTAAAACTTATTTTAGGCCAGG + Intronic
1003066170 6:2904918-2904940 TGAAATGCCTATATTAGGAGAGG + Intergenic
1003600412 6:7511886-7511908 TAAAAATCCTATTTTTGGCCAGG + Intergenic
1003756257 6:9124377-9124399 GTAAATGCATATTTGAGACCTGG + Intergenic
1004116733 6:12775923-12775945 TTAAATGCTTACTTTATACCAGG + Intronic
1004120940 6:12821705-12821727 TTGACTGCCTATTCTGGGCCAGG + Intronic
1005297960 6:24445320-24445342 GTAAATACCTATTTCAGGCCGGG - Intronic
1006110084 6:31739212-31739234 TTTAGTGCCTATTTTGGGCCAGG - Intronic
1006290931 6:33136123-33136145 TAAAATGATTATTTTAGGCTGGG - Intergenic
1006548115 6:34796353-34796375 TTAAATGCCTACCCTAGGCCAGG + Intronic
1006552966 6:34840254-34840276 TTAAATACATATTATTGGCCAGG + Intronic
1006710297 6:36062951-36062973 TTAAAAGCCAACTGTAGGCCAGG - Intronic
1007474268 6:42108366-42108388 TTAAATGCCTACTGGAGGCCTGG - Intronic
1007529984 6:42533643-42533665 TGAAACACCTATTATAGGCCAGG + Intergenic
1007895045 6:45346535-45346557 TTGAATTCCTATTATATGCCAGG - Intronic
1008403173 6:51088314-51088336 TTAAAAATATATTTTAGGCCAGG + Intergenic
1008605724 6:53137490-53137512 TAAAATGTCTACTTTTGGCCAGG + Intronic
1008810883 6:55497455-55497477 TTCAATACCTATTTTATGGCAGG + Intronic
1008831016 6:55761906-55761928 TTGAATGTTTATTTTATGCCAGG - Intronic
1008884193 6:56413980-56414002 TTAAAAGTCTATTTGTGGCCAGG + Intergenic
1008952630 6:57177118-57177140 TTAAGAACCTGTTTTAGGCCAGG + Intronic
1009430797 6:63563669-63563691 TTAAATGCCTAGCATATGCCAGG - Intronic
1009609587 6:65923251-65923273 TTAAAATTCTATTTTAGGCCGGG - Intergenic
1009651754 6:66485193-66485215 TTAAAATCCTCTTTTGGGCCGGG + Intergenic
1010199479 6:73270069-73270091 TTAAAAACCCATTTGAGGCCAGG - Intronic
1010199918 6:73273461-73273483 TAAAATGTCAATTTTAGGCTGGG - Intronic
1010224431 6:73475888-73475910 TCAAAAGCTTAATTTAGGCCGGG - Intronic
1010422656 6:75692322-75692344 TTAAAAGCATAAATTAGGCCAGG + Intronic
1010512120 6:76733028-76733050 TTAAATTTCTAATTTAAGCCAGG + Intergenic
1012251831 6:96989266-96989288 TTAAGTGCCTATGTTAAGCCAGG + Intronic
1012387026 6:98693863-98693885 TTAAATGCCTAGTGTGTGCCAGG - Intergenic
1012817796 6:104046098-104046120 TTAAAATCATATTTTAGGGCTGG + Intergenic
1013248580 6:108312158-108312180 TTAAAATTATATTTTAGGCCGGG - Intronic
1013534434 6:111051131-111051153 TTTAATGTAGATTTTAGGCCGGG + Intergenic
1013550852 6:111206370-111206392 TTAAAAGCATTTTTAAGGCCGGG - Intronic
1014100468 6:117506103-117506125 TTCAGTGCCTATTGTATGCCAGG + Intronic
1014180291 6:118377024-118377046 TTGAATGCCTATTATATGCCAGG + Intergenic
1014288803 6:119534834-119534856 TTAAATGTCTCTTTTATTCCTGG - Intergenic
1014948139 6:127520233-127520255 TTAAAAGCCAATTTTGAGCCTGG + Intronic
1015048411 6:128808475-128808497 TTAACTGCCTATTGTATGTCAGG + Intergenic
1016366477 6:143323960-143323982 TCAAATGCTGATTTTAGACCTGG - Intronic
1016397890 6:143646115-143646137 TTGAATGCCTGTTTAAGGACTGG - Intronic
1017136393 6:151151138-151151160 TTGAATGCCTATTTTTTTCCAGG - Intergenic
1017192818 6:151671694-151671716 TAAAATTTTTATTTTAGGCCAGG + Intronic
1017276534 6:152575824-152575846 TTAAATGCCTATTACATTCCAGG - Intronic
1017471601 6:154742694-154742716 TAAAATACCTATTATAGGTCAGG + Intronic
1017849280 6:158289874-158289896 TTAAATGCTTATGTTAGTCTGGG - Intronic
1018064324 6:160115071-160115093 CTGAATGTCTATTTTAGCCCAGG - Intergenic
1018779024 6:167045434-167045456 TTAAAAACCAATTTTGGGCCGGG + Exonic
1019352241 7:559778-559800 TTAAATAAATATTTTAGGCTGGG + Intronic
1019753649 7:2751089-2751111 TTACATGCTTATATTAGGGCCGG + Intronic
1021009952 7:15450122-15450144 TTAAATTTCTATTTCAGGGCCGG + Intronic
1021285478 7:18776459-18776481 TTGAATGCCTATTGTATGCCTGG + Intronic
1021565289 7:22010673-22010695 TTAAAAAGTTATTTTAGGCCAGG + Intergenic
1021653342 7:22852624-22852646 TTGAGTGCCTATTCTATGCCAGG - Intergenic
1022233409 7:28437199-28437221 GTTAATGCCTATTGTAGGCCAGG + Intronic
1023133912 7:37031956-37031978 TTACATGCTTATTTTAGCCCAGG - Intronic
1023499282 7:40830661-40830683 TTGAGTGCCTACTATAGGCCTGG - Intronic
1023678353 7:42654891-42654913 TAAAAGACCTATTTTAGGCTGGG - Intergenic
1023949754 7:44833644-44833666 TAAAATCCCAATTTTTGGCCTGG - Intronic
1024200735 7:47103444-47103466 TTAAATACCTATGTTTGGCTGGG - Intergenic
1024708333 7:51986097-51986119 TTAGAAAGCTATTTTAGGCCGGG - Intergenic
1025091667 7:56069307-56069329 TTAAATTCCCCTTATAGGCCAGG + Intronic
1025834065 7:65079443-65079465 TTAAATTCCCCTTATAGGCCAGG + Intergenic
1025903836 7:65768960-65768982 TTAAATTCCCCTTATAGGCCAGG + Intergenic
1025961614 7:66227324-66227346 TTAAAGGCTTATTTTGGGCTGGG - Intronic
1026662736 7:72316638-72316660 TTAAAAGAATATTTTAGGCCGGG + Intronic
1026817915 7:73526556-73526578 TTTAAAAACTATTTTAGGCCGGG + Intergenic
1027161530 7:75806133-75806155 TCAAAGGCCTATCATAGGCCAGG - Intergenic
1027178135 7:75917866-75917888 TCAAATGCCAATTCTAGGCTGGG + Intronic
1027183418 7:75955135-75955157 TAAAATGCCAATTCTAGGCTGGG - Intronic
1027304007 7:76873461-76873483 TTGCATGCCTATTCTAGGCATGG + Intergenic
1027527508 7:79288842-79288864 TTGTATGTCTATTTTATGCCTGG - Intronic
1027533698 7:79368551-79368573 TAAAATGTCTATTGTAGGCCAGG + Intronic
1027939220 7:84652128-84652150 TTGAGTGACTATTTTATGCCAGG + Intergenic
1027943524 7:84716052-84716074 TTAAATGTTTATTTTATGCTAGG - Intergenic
1028208604 7:88045311-88045333 TGAAATGTCTCTATTAGGCCTGG - Intronic
1028552283 7:92082228-92082250 TTACATTACTATTTTAGGCCAGG - Intronic
1029172118 7:98638467-98638489 GTTAATGCCTATTTTATACCAGG + Intergenic
1029265998 7:99341011-99341033 TTAAATTGGAATTTTAGGCCGGG + Intronic
1030252079 7:107457723-107457745 AAAAACTCCTATTTTAGGCCGGG - Intronic
1030361860 7:108603612-108603634 TTAAATGCTTATTTCCAGCCAGG - Intergenic
1030525120 7:110643454-110643476 TTAAATGCATCCTTTAGGGCAGG - Intergenic
1030593695 7:111511025-111511047 TGAAGTGCCATTTTTAGGCCTGG - Intronic
1030687503 7:112502439-112502461 TTTATTGCCTATTTTGTGCCAGG + Intergenic
1030860249 7:114616456-114616478 TTAATCACCTATTGTAGGCCAGG - Intronic
1030911526 7:115256422-115256444 TAAAATACCTAGTTTGGGCCAGG - Intergenic
1031048642 7:116922412-116922434 TTAAATGTAAATTTTGGGCCAGG + Intergenic
1031309357 7:120175766-120175788 TTAAATGCCTATATTGGAGCAGG - Intergenic
1031480721 7:122275362-122275384 TTAAATGCCTATAGTATTCCTGG - Intergenic
1031834550 7:126667680-126667702 TTAAATACCTGTCTTGGGCCTGG - Intronic
1032174690 7:129612988-129613010 TTAATTGCTTATTTTAGAGCTGG + Intronic
1032190926 7:129765369-129765391 TTAAATGCCTAGATTATGGCTGG + Intergenic
1033189390 7:139263283-139263305 TTAATTGCCTACTTTATGCCAGG + Intronic
1033240078 7:139671054-139671076 TTAAAAACCTATTTTGGGCCGGG - Intronic
1033294650 7:140120692-140120714 TTAAATGCCTATTATATGGTAGG + Intronic
1033373573 7:140735484-140735506 TTGAGTGCTTATTATAGGCCAGG - Intronic
1033600672 7:142886203-142886225 TTATATACCTATTTCAGGCCTGG - Intergenic
1033787234 7:144747488-144747510 TTAAATTTCCACTTTAGGCCAGG + Intronic
1033870021 7:145741662-145741684 TTAAACACCTATTATAGGCCGGG + Intergenic
1033889846 7:145998275-145998297 TTAAAAGAAAATTTTAGGCCGGG + Intergenic
1034215644 7:149403818-149403840 TAAAATGTATATTTTAGGCTGGG + Intergenic
1034493620 7:151407541-151407563 AGAAATGCCAATTCTAGGCCGGG + Intronic
1034565313 7:151909666-151909688 TTATATGTATAATTTAGGCCAGG + Intergenic
1034567029 7:151923618-151923640 TTAAGTGCCTATTCTGTGCCAGG + Intergenic
1034819406 7:154202852-154202874 TTAAAGGCCTAATATAGTCCAGG - Intronic
1035144282 7:156798246-156798268 TTAAATGCTTATTTTATGACAGG - Intronic
1035875365 8:3183051-3183073 TAAAAAGCCTCTTCTAGGCCGGG - Intronic
1035930355 8:3773580-3773602 CTAAATACCTATTATAGGACGGG - Intronic
1036555911 8:9860331-9860353 TTAAAGGCTTATTCTGGGCCAGG - Intergenic
1037354242 8:17999881-17999903 TAAAATGCCTACTTAATGCCAGG + Intronic
1037562838 8:20089953-20089975 TAAAAAGGCAATTTTAGGCCGGG - Intergenic
1037680031 8:21089601-21089623 CTAAGTGCCTATTATAGGCTTGG - Intergenic
1037763037 8:21754802-21754824 TTAAAGGGCTATTGTTGGCCAGG - Intronic
1039853703 8:41394848-41394870 TTAAATGACTGGTTTTGGCCAGG + Intergenic
1040035453 8:42865686-42865708 TTAAATTCCAAGTTAAGGCCGGG + Intronic
1040596045 8:48838777-48838799 TTAAAAGCATATATTAGGACTGG - Intergenic
1041062048 8:54043854-54043876 TAAAATGCAGATTTGAGGCCGGG - Intergenic
1041237831 8:55822363-55822385 TAAAAAGCCATTTTTAGGCCGGG - Intronic
1041344504 8:56882827-56882849 TTAAATGTCATTTTTAGGCTTGG + Intergenic
1041517483 8:58716379-58716401 TTAAAAATATATTTTAGGCCGGG + Intergenic
1042014909 8:64298226-64298248 TTAAAAGCCTACCTTAGGTCAGG + Intergenic
1042251691 8:66762262-66762284 TTAAAAGTCTGTTATAGGCCGGG - Intronic
1042537523 8:69873580-69873602 TTAAAAGCTTTTTTTGGGCCAGG - Intergenic
1042616958 8:70660247-70660269 TTAAAAAACTATTTTATGCCAGG - Exonic
1042648025 8:71008962-71008984 TTAAAAATCTCTTTTAGGCCTGG - Intergenic
1042684659 8:71424963-71424985 GAAAATGCACATTTTAGGCCGGG + Intronic
1042735975 8:71989145-71989167 TAAAATGCCATTTTGAGGCCAGG + Intronic
1043063959 8:75542889-75542911 TTAAATATGTATTTCAGGCCAGG + Intronic
1043434020 8:80221092-80221114 TTGAAAGCTTATTTCAGGCCTGG + Intronic
1043879428 8:85524877-85524899 TTAAAATCCTGTTTTAGGCCAGG + Intergenic
1043968726 8:86507632-86507654 TTGAAGTCCCATTTTAGGCCTGG - Intronic
1044365741 8:91342966-91342988 CCAAATGCCTCTTTTAGGCAAGG + Intronic
1044657930 8:94567549-94567571 TTAAATACCTATTTTCAGGCCGG - Intergenic
1045477136 8:102562839-102562861 TTAAAAGCTTCCTTTAGGCCAGG + Intergenic
1045828493 8:106429362-106429384 AGAAATGCTTACTTTAGGCCGGG + Intronic
1046124436 8:109886422-109886444 CTAAATGCCTACTTTTGGCTGGG - Intergenic
1046141544 8:110100280-110100302 TTGAATGCTTATTATATGCCAGG + Intergenic
1046731439 8:117730507-117730529 TTAAATGTCTATTAAGGGCCAGG - Intergenic
1046800566 8:118422189-118422211 TTAAATGCCTACTTTATGCCAGG + Intronic
1047059184 8:121204183-121204205 TTAAGTGTCTATTATATGCCAGG + Intergenic
1048244770 8:132781724-132781746 ATAAATCACTACTTTAGGCCTGG - Intronic
1050075029 9:1854357-1854379 GAAAATTCCTATTTTGGGCCAGG - Intergenic
1050299800 9:4246079-4246101 TAAAATACCTATTTCAGGCCAGG + Intronic
1051254663 9:15201310-15201332 CTTAATGCCTATTTTATACCAGG + Intronic
1051428857 9:16961803-16961825 TTAAACACCTATTTTATGCAAGG - Intergenic
1053203016 9:36165518-36165540 TTAAAAGGGTATTTTTGGCCAGG + Intergenic
1053405148 9:37867892-37867914 TTATATGCCTAGTTTAGTACTGG + Intronic
1054874480 9:70081003-70081025 TTAAGTGCCTACTTTATGCCAGG - Intronic
1055161771 9:73138339-73138361 TTAAGTGCCTATTATGAGCCAGG + Intergenic
1055728674 9:79258513-79258535 TTAAATTCCTACTTTGTGCCAGG - Intergenic
1055852271 9:80645852-80645874 TTAAAAACCTATTATAGGGCTGG - Intergenic
1056097565 9:83271104-83271126 TTAAATGCCTATTCCATGTCAGG - Intronic
1057074018 9:92125526-92125548 TTAAAAACCTATTGTAGGCTGGG + Intergenic
1057085371 9:92205030-92205052 TTAAAAACCTATTGTAGGCTGGG - Intergenic
1057232297 9:93330574-93330596 AAAAATGTCTATTCTAGGCCAGG + Intronic
1058145419 9:101405778-101405800 AAACATGCCCATTTTAGGCCAGG + Intronic
1058171332 9:101684437-101684459 TTAAGTGCCTACTATAGGCTAGG + Intronic
1058431164 9:104920803-104920825 TTAAAAGCTTGCTTTAGGCCGGG - Intronic
1058437696 9:104978256-104978278 TTAGATGACTATTATATGCCAGG - Intergenic
1058529506 9:105891664-105891686 TTAAATGCTTACTCTGGGCCTGG + Intergenic
1058888411 9:109340713-109340735 TTAAATGGATATTTTCAGCCAGG + Intergenic
1060494308 9:124106669-124106691 TTAAATGCCTACTGTGTGCCAGG - Intergenic
1060802968 9:126556491-126556513 TTAAAATCCTATTATAGGCCGGG - Intergenic
1061076823 9:128346527-128346549 TTAAAAACTTTTTTTAGGCCGGG - Intronic
1061760132 9:132845492-132845514 TTGAAAGACTATTCTAGGCCGGG + Intronic
1186230109 X:7444599-7444621 TAAAATGACAATTTTATGCCAGG - Intergenic
1186688924 X:11954194-11954216 CTAAATGCCTCTTTTAGGAGAGG + Intergenic
1186917105 X:14234584-14234606 TTACATGCCTATTACATGCCAGG + Intergenic
1187268506 X:17759257-17759279 TAAAATCCCTGTTTTTGGCCAGG + Intergenic
1187720157 X:22141552-22141574 TTTAATGCCAAGTTTAGGACTGG - Intronic
1188489868 X:30725946-30725968 TAAAATGCCATTTTAAGGCCAGG - Intronic
1188708504 X:33364575-33364597 TTAAAAGGCTATTTTAGGCCGGG - Intergenic
1189170792 X:38907396-38907418 TTGAATGCCTACTTTGGGTCAGG + Intergenic
1189353606 X:40295380-40295402 TTAAAAGCGTATTATAGACCGGG - Intergenic
1189503121 X:41583059-41583081 GTAAATGCCTACTGTATGCCAGG - Intronic
1189898937 X:45685867-45685889 TTAAAGGCCAATATTTGGCCAGG - Intergenic
1190120146 X:47652306-47652328 TTAAATGCCTACTGTATGCCAGG + Intronic
1191233591 X:58116686-58116708 TAGAATGCCTTTTTTTGGCCAGG - Intergenic
1191234484 X:58123147-58123169 TGTAATGCCTATTTTTCGCCAGG - Intergenic
1191241464 X:58193428-58193450 TAAAATGCCTATGGTCGGCCAGG - Intergenic
1191245609 X:58225958-58225980 TTAAATTTCTGGTTTAGGCCAGG - Intergenic
1191249041 X:58250808-58250830 TCAAATCCCTATTTTCAGCCAGG - Intergenic
1191591102 X:62886327-62886349 ATAAAAGACTATGTTAGGCCAGG + Intergenic
1191668902 X:63730969-63730991 TTAAATGTCTATTTTGGGGGTGG - Intronic
1191730706 X:64332213-64332235 TTTAATACCTATTTTGTGCCAGG - Intronic
1191901416 X:66044424-66044446 TTCAATACCTATTATATGCCTGG - Intergenic
1191998600 X:67123880-67123902 AGAAATGCCTATTTTGGGCAAGG + Intergenic
1192130974 X:68549608-68549630 TCAAAAGTCAATTTTAGGCCTGG - Intergenic
1192210554 X:69125188-69125210 CTGAATGCCTACTCTAGGCCAGG + Intergenic
1192243789 X:69357071-69357093 TCAAATGCCTATTTTGTCCCTGG + Intergenic
1193132675 X:77934116-77934138 TAAAATGTCTTTTCTAGGCCAGG + Intronic
1194053949 X:89106786-89106808 AAAAATACCTATTTAAGGCCAGG - Intergenic
1194317976 X:92405797-92405819 TTAAAAGCTTTTTCTAGGCCGGG + Intronic
1194699175 X:97092887-97092909 TTAAAAATCTATTCTAGGCCAGG + Intronic
1194720679 X:97336691-97336713 TTAAATGCCTACTATGTGCCAGG - Intronic
1195117991 X:101718874-101718896 GTAAATCCCTAATTTTGGCCTGG - Intergenic
1195446833 X:104961800-104961822 TTGAGTGCCTATTCTGGGCCAGG - Intronic
1195484681 X:105390423-105390445 TTAAATGCCAATTATACGTCAGG - Intronic
1195497373 X:105552289-105552311 TTAAATGCCTACTATGAGCCAGG - Intronic
1195686772 X:107594584-107594606 TTTAAGAACTATTTTAGGCCGGG + Intronic
1195986518 X:110636625-110636647 TTTAATGCCTACTATATGCCAGG + Intergenic
1196158814 X:112460011-112460033 GTGAATGCCTACTTTATGCCAGG + Intergenic
1196259241 X:113558667-113558689 TTAAATGCCTACTATATGCCAGG + Intergenic
1196541574 X:116916739-116916761 TTAAATTCTTATTTTAGGTTTGG + Intergenic
1196603767 X:117631921-117631943 TTGAGTGCCTACTTTATGCCTGG + Intergenic
1196913491 X:120508788-120508810 TAAAAAGCACATTTTAGGCCAGG + Intergenic
1197282536 X:124553800-124553822 TTGAATGCTTACTTTAAGCCAGG - Intronic
1197604263 X:128565680-128565702 GAAAATGCATTTTTTAGGCCAGG - Intergenic
1197790069 X:130245682-130245704 TTATTTACTTATTTTAGGCCTGG - Intronic
1197954952 X:131936369-131936391 TTGAATGCCTATTATGTGCCAGG - Intergenic
1198139171 X:133785591-133785613 TTAAATGCCTATTGTGTGCCAGG + Intronic
1198374349 X:136023104-136023126 TTAAAGGAGTATTATAGGCCAGG - Intronic
1198659195 X:138948388-138948410 CTAAATCCCTACTTTTGGCCAGG + Intronic
1198732145 X:139743102-139743124 ATATATACCTATTTTAGGCCTGG + Intronic
1198764214 X:140064427-140064449 TTAAATGCCTACTATGTGCCAGG - Intergenic
1198857948 X:141038068-141038090 TTTAATAACTATTTTAGGCTGGG + Intergenic
1198904748 X:141549302-141549324 TTTAATAACTATTTTAGGCTGGG - Intergenic
1201598494 Y:15699675-15699697 TAAAATGACAATTTTATGCCAGG - Intergenic
1201681768 Y:16653754-16653776 TTAAATGGCTATTTTGGGTTTGG - Intergenic
1201890088 Y:18934144-18934166 TAAAATTTATATTTTAGGCCTGG + Intergenic
1202330813 Y:23750763-23750785 TTAAATGCTGATATTCGGCCAGG + Intergenic
1202539956 Y:25919298-25919320 TTAAATGCTGATATTCGGCCAGG - Intergenic