ID: 1143960702

View in Genome Browser
Species Human (GRCh38)
Location 17:10716048-10716070
Sequence CTGAATATTGATGTGGACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 1, 2: 0, 3: 19, 4: 156}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143960702 Original CRISPR CTGAATATTGATGTGGACAT GGG (reversed) Intronic
907262132 1:53227021-53227043 CTGAATATTGGTGTGGACATGGG - Exonic
909021994 1:70441711-70441733 CTGAATATAGAAATGGACAGTGG - Intergenic
909041633 1:70660124-70660146 CTGAATATTGACATTGACTTTGG - Intergenic
909284304 1:73795507-73795529 CTGAAGTATGTTGTGGACATTGG - Intergenic
909675145 1:78231137-78231159 CTGAATATAGAAGCAGACATAGG + Intergenic
909888965 1:80979028-80979050 CTTAATATTGATGTGTGCAATGG + Intergenic
911950346 1:104165850-104165872 CTGAACCCTGGTGTGGACATAGG - Intergenic
913048119 1:115090190-115090212 CTTAATTATGATGTGGAGATGGG + Intergenic
915738362 1:158098961-158098983 CTGAACATTGCTATGAACATAGG - Intronic
919194077 1:194261084-194261106 CTGCATATTGAATTGGACATAGG + Intergenic
921697532 1:218229214-218229236 CTTAATATTAATGTGTTCATAGG - Intergenic
923698079 1:236274281-236274303 TTAAATATTGATGAGGATATGGG - Intronic
924140132 1:241013401-241013423 GTGAACATTCATGTGGACACAGG - Intronic
1063845797 10:10125541-10125563 CAGAATATTGAGGTAGACACAGG - Intergenic
1064514811 10:16135308-16135330 CTGTATCTTGATCTGGACAACGG + Intergenic
1068798750 10:61115047-61115069 CTGTAGATTGAGGTGGAGATAGG + Intergenic
1070784947 10:79157532-79157554 CTGGACATTGAGCTGGACATTGG - Intronic
1070875851 10:79808680-79808702 CTGAATATTGATATATAAATTGG + Intergenic
1071717643 10:88113459-88113481 CTAAATTTTGATGTGGAAACAGG - Intergenic
1073844415 10:107537502-107537524 CTGTCTTTGGATGTGGACATCGG - Intergenic
1076030268 10:127151584-127151606 CTGAATAGAGATGTGGCCCTCGG - Intronic
1080323781 11:31046369-31046391 CTGAATATGACTGAGGACATTGG - Intronic
1082169985 11:48992154-48992176 CTGAATGTTGATCTGGAAATTGG + Intergenic
1082607902 11:55264608-55264630 CTGAATGTGGATCTGGAAATTGG - Intronic
1083025781 11:59549696-59549718 CAGAATATTGTTGAGGAAATGGG + Intergenic
1086622341 11:88902285-88902307 CTTAATAGTCATGTGGACTTGGG + Intronic
1086692550 11:89804743-89804765 CTGAACATAGATCTGGAAATTGG + Intronic
1086695844 11:89844473-89844495 CTGAATGTTGATCTGGAAATTGG - Intergenic
1086702711 11:89917982-89918004 CTGAATGTGGATCTGGAAATTGG + Intronic
1086703456 11:89926468-89926490 CTGAATGTGGATCTGGAAATTGG - Intergenic
1086710310 11:90000010-90000032 CTGAATGTTGATCTGGAAATTGG + Intergenic
1086713250 11:90034916-90034938 CTGAACATAGATCTGGAAATTGG - Intronic
1087096743 11:94326330-94326352 CTGAATATATAAGTGGACAATGG - Intergenic
1088246843 11:107827053-107827075 ATGAATATTGATGTATTCATTGG + Intronic
1091862574 12:3799321-3799343 CTGAATAGAGGTGTGGAGATGGG + Intronic
1094115648 12:26909389-26909411 CTGAATAATGGTGTGTCCATAGG - Intronic
1095391663 12:41714455-41714477 CTGAATATTGAAGAGGGCCTGGG + Intergenic
1097584763 12:61502223-61502245 ATGAAAATTTATGTGAACATGGG + Intergenic
1097759779 12:63449751-63449773 CTGAATATTGAAATGCATATGGG - Intergenic
1099164617 12:79288314-79288336 CAGAATGTTGAAGTGAACATGGG + Intronic
1099454076 12:82843400-82843422 GTGGATATGGATGTGGACACTGG - Intronic
1106695915 13:32172295-32172317 GTGAATATTGATGTGGATGTGGG + Intronic
1106695923 13:32172361-32172383 ATGGATATGGATGTGGATATAGG + Intronic
1108122652 13:47206563-47206585 CTGAATATGGATGTGCTAATTGG + Intergenic
1108994487 13:56710518-56710540 CACATTATTGATGTTGACATAGG + Intergenic
1114287039 14:21254554-21254576 CTGAAGATTGATGTGGATTTGGG - Intronic
1115000556 14:28416131-28416153 CTGTATCTGGATGTGCACATAGG - Intergenic
1115052046 14:29074442-29074464 CTGAATTTTGATGAGGAGACAGG - Intergenic
1116317128 14:43411341-43411363 CTGAATGTTAGTGTAGACATGGG + Intergenic
1118132276 14:62980261-62980283 CTGAATATATTTGTGGATATTGG - Intronic
1119233155 14:72997038-72997060 AAGAAGATGGATGTGGACATGGG - Intronic
1120085195 14:80264005-80264027 CTGAATATAATTGTGGCCATGGG + Intronic
1121414260 14:93768174-93768196 CTGAACATTGAGGTGGAAAAAGG - Intronic
1122137441 14:99642880-99642902 CTGAATATTGACAAGGACATTGG - Intergenic
1127616803 15:60694324-60694346 TTGACTTTTGATGTGGGCATGGG - Intronic
1131793960 15:95994299-95994321 CTGACTATTGATACAGACATAGG + Intergenic
1135498659 16:22974846-22974868 CTGAATATACAGGTGGACAAAGG + Intergenic
1138040121 16:53654501-53654523 CTGAATCTTGAGGTAGAAATAGG + Intronic
1138190832 16:55012676-55012698 CTGAATCTTGATGTTCTCATGGG + Intergenic
1139268190 16:65659002-65659024 CTGCATGATGATGTGTACATGGG + Intergenic
1140413446 16:74755932-74755954 CTGTATCTTGATTTGGGCATTGG - Intronic
1143960702 17:10716048-10716070 CTGAATATTGATGTGGACATGGG - Intronic
1146291882 17:31613696-31613718 CTGAATACTGTTCTGGCCATAGG + Intergenic
1147522262 17:41184926-41184948 CTGAGTATAAAAGTGGACATGGG - Exonic
1147875135 17:43615630-43615652 AGGAAGATAGATGTGGACATTGG + Intergenic
1150357868 17:64503833-64503855 CTGATGATTGATGTGGACAATGG + Exonic
1150666008 17:67139180-67139202 CTGAATTTGTATCTGGACATGGG - Intronic
1155345294 18:24851563-24851585 CTGAAAATTTTTCTGGACATAGG - Intergenic
1156736665 18:40268131-40268153 CTGGACATTGATGTGGAGAGAGG + Intergenic
1157051081 18:44165985-44166007 CTAAATATAGATATGGATATAGG - Intergenic
1159817158 18:73089222-73089244 TTGAATATAGATATAGACATAGG - Intergenic
1161568907 19:5019266-5019288 GTGGATGTTGGTGTGGACATTGG + Intronic
929832336 2:45357174-45357196 GTGAAGAGTGATGAGGACATGGG - Intergenic
931081020 2:58770889-58770911 CTGATTGTTGATGAGGACACAGG + Intergenic
938315194 2:130320339-130320361 CTGTACATTGAGCTGGACATGGG - Intergenic
938945501 2:136208528-136208550 CTGAATATTTAATTAGACATTGG - Intergenic
939673599 2:145043822-145043844 CTGAATATGACTGTGGAAATGGG - Intergenic
940704102 2:157082274-157082296 CTGAATATTCTTGTGAACTTGGG - Intergenic
941833454 2:169989043-169989065 TTGAAGATAGATGGGGACATGGG - Intronic
942597087 2:177601571-177601593 CTGAAAATGAATGTGGCCATTGG - Intergenic
942790091 2:179751322-179751344 CAGAATATTGATGTGGGCAAGGG + Intronic
943251429 2:185525039-185525061 GTAGATATTGATGTAGACATAGG - Intergenic
943491630 2:188561392-188561414 CTGTATGTTGATGTGGGCAGTGG + Intronic
945562593 2:211356963-211356985 CACAATATTGATCTGGACATTGG - Intergenic
945719447 2:213401114-213401136 CTGATTATTGATGTAGAGCTTGG + Intronic
947177587 2:227383273-227383295 CTAAATATTTTTGTGGACATGGG - Intergenic
948382394 2:237559820-237559842 CTGAACATGGGTGTGGACAGAGG - Intergenic
948402396 2:237693073-237693095 CTGCATATTGAGCTGGACAACGG - Intronic
948463560 2:238141670-238141692 CTGAATAGTGATGTCCTCATGGG - Intronic
1172460112 20:35111323-35111345 CTGAATAATGAAGTGGACTGTGG + Intergenic
1173178265 20:40782036-40782058 CTCAAAATTGATGTGTACAAAGG - Intergenic
1177862161 21:26467107-26467129 CTGAATTTTGATGATGATATTGG + Exonic
1178280464 21:31278050-31278072 CTGAAGATTGAGTGGGACATGGG - Intronic
1181475907 22:23167635-23167657 CTGAATACTGAAATGGACAGAGG + Intergenic
1185289907 22:50018029-50018051 CTGCATATTGTTGGGGGCATGGG - Intronic
950885187 3:16356597-16356619 CTGGTTATTGAAGTGGAGATGGG - Intronic
950959703 3:17092793-17092815 CTGAATATGTATGTGGAAAGAGG - Intergenic
951621674 3:24608709-24608731 CTTAAAATTGATGTTTACATAGG - Intergenic
951668411 3:25152825-25152847 ATGAATTTTGATGTTCACATAGG - Intergenic
952280354 3:31917058-31917080 CTCATTATTGATGTGCACAAGGG - Intronic
954284737 3:49610880-49610902 CTGCATAGTGATGCAGACATTGG + Intronic
954311121 3:49768241-49768263 GTGAATAATGCTGTGAACATTGG - Intronic
956438748 3:69260018-69260040 CTGAATATTAATCTTCACATAGG - Intronic
956970587 3:74519067-74519089 GTGTATATTTATATGGACATAGG + Intronic
957684696 3:83486643-83486665 CTGAATCTGGAGGTGGACAAGGG + Intergenic
957935177 3:86933079-86933101 CTGAATTTTGATGCAGAAATTGG + Intergenic
958515794 3:95113811-95113833 CTGAATTTTTATGAGGAGATTGG + Intergenic
962255092 3:133865086-133865108 CTGAAGATTGGTGGGGACAGTGG + Intronic
962386569 3:134937069-134937091 CTGAATTTTAAAGGGGACATTGG + Intronic
965133254 3:164728201-164728223 CTGAATATTGACCTGGATAGTGG - Intergenic
968250611 3:197208255-197208277 CTATATACTGATGAGGACATAGG + Intronic
969503189 4:7567015-7567037 CTGAACTTAGATTTGGACATAGG + Intronic
969591523 4:8124725-8124747 GTGAATATTCGTGTGGACATAGG + Intronic
970964440 4:21912163-21912185 CTGAATATTGTTATGGGTATTGG + Intronic
974690887 4:65296858-65296880 CTGCATAATGATGTAGACAATGG + Intergenic
975387594 4:73775619-73775641 CTGAATTTTGGTGAGGATATGGG + Intergenic
976775602 4:88702869-88702891 CTGAATATTCCTATGGACAATGG + Intronic
978045218 4:104117148-104117170 CTAATTATTGAAGTGGAGATTGG - Intergenic
979010550 4:115363288-115363310 CTGAATATGAATGTATACATGGG - Intergenic
979335746 4:119459667-119459689 CTGTATATTAATTTGGACAGTGG - Intergenic
980149717 4:129030862-129030884 CAGAATATTGATGTAGAATTCGG - Intronic
983614514 4:169687013-169687035 CAGAATAATCATGTGGACAAAGG - Intronic
984501046 4:180558935-180558957 CAGAATATTGATTTGGGCTTTGG + Intergenic
984598494 4:181699092-181699114 CTGAATCTTGATGGAGAAATGGG - Intergenic
985179555 4:187241988-187242010 CTATATCTTGATGTGGACAGTGG - Intergenic
990401776 5:55445253-55445275 CTGAACATGGATGTGGATGTTGG - Intronic
990587440 5:57225810-57225832 GGAAAAATTGATGTGGACATGGG + Intronic
991117676 5:62972794-62972816 CTGAAGATGGATGTGGGCAAAGG - Intergenic
993016249 5:82538099-82538121 GGGAATATTGTTGTTGACATTGG - Intergenic
995048727 5:107677512-107677534 ATGAAAAGTGATGTGGAAATTGG - Intergenic
997864686 5:137450663-137450685 CTGAATATTGTTGTGAAGTTCGG - Intronic
999035295 5:148342094-148342116 CTGAAAGATGATGTGGAAATTGG - Intergenic
999622967 5:153490944-153490966 CTGGATATTGTTGGGGAAATTGG - Intronic
1001455672 5:171858107-171858129 ATGCATTTGGATGTGGACATTGG - Intergenic
1004782739 6:18929662-18929684 CTCACTATTAATGTGTACATTGG + Intergenic
1006264588 6:32909067-32909089 CTAAATAGTGATGTGGCCTTGGG + Intergenic
1006488315 6:34363651-34363673 CTTAATGTTGAACTGGACATGGG - Intronic
1008267036 6:49440219-49440241 CTTGGTTTTGATGTGGACATAGG - Exonic
1009793036 6:68428591-68428613 CTGAAGATGGATCTGGACATTGG - Intergenic
1010089256 6:71960759-71960781 CTAAATATTCAAGTAGACATGGG + Intronic
1012954060 6:105549277-105549299 CTGAATAATGAAGTGGACAACGG - Intergenic
1015133045 6:129835834-129835856 CTGCATCTTGATGTGGAGATGGG + Intronic
1015498528 6:133906525-133906547 CTGGATATTGAAGAGGGCATTGG + Intergenic
1016193450 6:141300254-141300276 CTGAATATTGCTGAAGATATAGG - Intergenic
1017037635 6:150280706-150280728 ATGAATATTGATGGGGCCATAGG - Intergenic
1017742860 6:157422260-157422282 GTTAAGATAGATGTGGACATTGG + Intronic
1022549314 7:31222824-31222846 CTGTATATTGCTGTGGGCAGTGG + Intergenic
1022786309 7:33641013-33641035 CAGAATAGTGCTGAGGACATGGG - Intergenic
1023070590 7:36428639-36428661 ATCAATATTGATGTGAATATAGG - Intronic
1023072740 7:36453153-36453175 CAGAAAAGTGATGTGGACATAGG + Exonic
1025480750 7:60979689-60979711 ATCAATATTGTTGTGGATATTGG + Intergenic
1025488292 7:61079334-61079356 ATCAATATTGTTGTGGCCATTGG - Intergenic
1026227487 7:68455384-68455406 CAGAATATTTATGTTGAGATAGG + Intergenic
1028074185 7:86490964-86490986 CTGAATATTAATATGTACATTGG - Intergenic
1028811186 7:95088528-95088550 CTGAATATTGTTTTGGAAGTTGG + Intronic
1031110513 7:117602749-117602771 GTGAATTTAGATGTGGGCATGGG + Intronic
1031190507 7:118543715-118543737 ATGAATATTGAAGTGTCCATAGG + Intergenic
1033430555 7:141285534-141285556 CTGAAAATTTATGTAGAAATTGG + Intronic
1033915939 7:146325647-146325669 ATGAATATGGAGGTGAACATAGG + Intronic
1035853666 8:2948510-2948532 CTATATATTGATGTGGAAAGAGG - Intronic
1036038937 8:5052665-5052687 CTGAACATGGATGTGGATACTGG + Intergenic
1036392926 8:8340402-8340424 ATGAATATTCATGTGGCCCTTGG - Intronic
1040930320 8:52727604-52727626 CTGAACATTTGTGTGGACATAGG - Intronic
1043429974 8:80185240-80185262 CTGAATATACAAATGGACATTGG + Intronic
1045953548 8:107879869-107879891 AAGAATAGTGAAGTGGACATAGG - Intergenic
1047048358 8:121080189-121080211 CTGAGTACAGATGTGGGCATTGG + Intergenic
1047142399 8:122155862-122155884 CTTAAAAATGATGAGGACATCGG + Intergenic
1047662799 8:127056213-127056235 CAGATGATTGACGTGGACATTGG + Intergenic
1056614515 9:88152253-88152275 ATGTATTTTGTTGTGGACATAGG + Intergenic
1057793322 9:98138439-98138461 AAGAATATTGTTGTGAACATTGG - Intronic
1188149893 X:26659930-26659952 CTGAATATTCATGTGCAAAATGG + Intergenic
1188272805 X:28162024-28162046 GTGAATATTGATGTTCACCTAGG - Intergenic
1196295330 X:113990370-113990392 CTGTATCTTTATGTGTACATGGG + Intergenic
1196756676 X:119163326-119163348 GTGAATAATGCTGTGAACATGGG - Intergenic
1197620464 X:128742112-128742134 TTGAATATTCATGTGGAATTAGG + Intergenic
1200314158 X:155114159-155114181 GTGAATAATGCTGTGAACATAGG - Intronic
1201315650 Y:12643070-12643092 CTGAATATACAAATGGACATTGG + Intergenic