ID: 1143963346

View in Genome Browser
Species Human (GRCh38)
Location 17:10738604-10738626
Sequence GCCTTTCCTCTGTGTGGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143963346_1143963354 3 Left 1143963346 17:10738604-10738626 CCTGGCCCACACAGAGGAAAGGC No data
Right 1143963354 17:10738630-10738652 GTGAGGACACAGGGAGAAGAGGG No data
1143963346_1143963353 2 Left 1143963346 17:10738604-10738626 CCTGGCCCACACAGAGGAAAGGC No data
Right 1143963353 17:10738629-10738651 TGTGAGGACACAGGGAGAAGAGG No data
1143963346_1143963350 -7 Left 1143963346 17:10738604-10738626 CCTGGCCCACACAGAGGAAAGGC No data
Right 1143963350 17:10738620-10738642 GAAAGGCCATGTGAGGACACAGG No data
1143963346_1143963357 26 Left 1143963346 17:10738604-10738626 CCTGGCCCACACAGAGGAAAGGC No data
Right 1143963357 17:10738653-10738675 CATTTATAAGCCGGGAAGAGAGG No data
1143963346_1143963356 18 Left 1143963346 17:10738604-10738626 CCTGGCCCACACAGAGGAAAGGC No data
Right 1143963356 17:10738645-10738667 GAAGAGGGCATTTATAAGCCGGG No data
1143963346_1143963351 -6 Left 1143963346 17:10738604-10738626 CCTGGCCCACACAGAGGAAAGGC No data
Right 1143963351 17:10738621-10738643 AAAGGCCATGTGAGGACACAGGG No data
1143963346_1143963355 17 Left 1143963346 17:10738604-10738626 CCTGGCCCACACAGAGGAAAGGC No data
Right 1143963355 17:10738644-10738666 AGAAGAGGGCATTTATAAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143963346 Original CRISPR GCCTTTCCTCTGTGTGGGCC AGG (reversed) Intergenic