ID: 1143965009

View in Genome Browser
Species Human (GRCh38)
Location 17:10750879-10750901
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143965008_1143965009 -7 Left 1143965008 17:10750863-10750885 CCAGCATTGAGTGGCAATCAAAA No data
Right 1143965009 17:10750879-10750901 ATCAAAAATGTTTCCAGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143965009 Original CRISPR ATCAAAAATGTTTCCAGATG TGG Intergenic
No off target data available for this crispr