ID: 1143965955

View in Genome Browser
Species Human (GRCh38)
Location 17:10756642-10756664
Sequence ACCAGAAATGTCTCCAAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143965949_1143965955 6 Left 1143965949 17:10756613-10756635 CCAGTAGTAACCCTCCTCCACAT No data
Right 1143965955 17:10756642-10756664 ACCAGAAATGTCTCCAAACCTGG No data
1143965947_1143965955 16 Left 1143965947 17:10756603-10756625 CCACCAGATGCCAGTAGTAACCC No data
Right 1143965955 17:10756642-10756664 ACCAGAAATGTCTCCAAACCTGG No data
1143965945_1143965955 23 Left 1143965945 17:10756596-10756618 CCTCTACCCACCAGATGCCAGTA 0: 24
1: 242
2: 719
3: 1095
4: 1544
Right 1143965955 17:10756642-10756664 ACCAGAAATGTCTCCAAACCTGG No data
1143965950_1143965955 -4 Left 1143965950 17:10756623-10756645 CCCTCCTCCACATGCCACAACCA No data
Right 1143965955 17:10756642-10756664 ACCAGAAATGTCTCCAAACCTGG No data
1143965944_1143965955 28 Left 1143965944 17:10756591-10756613 CCTGGCCTCTACCCACCAGATGC 0: 24
1: 250
2: 688
3: 1182
4: 1566
Right 1143965955 17:10756642-10756664 ACCAGAAATGTCTCCAAACCTGG No data
1143965952_1143965955 -8 Left 1143965952 17:10756627-10756649 CCTCCACATGCCACAACCAGAAA No data
Right 1143965955 17:10756642-10756664 ACCAGAAATGTCTCCAAACCTGG No data
1143965951_1143965955 -5 Left 1143965951 17:10756624-10756646 CCTCCTCCACATGCCACAACCAG No data
Right 1143965955 17:10756642-10756664 ACCAGAAATGTCTCCAAACCTGG No data
1143965948_1143965955 13 Left 1143965948 17:10756606-10756628 CCAGATGCCAGTAGTAACCCTCC No data
Right 1143965955 17:10756642-10756664 ACCAGAAATGTCTCCAAACCTGG No data
1143965946_1143965955 17 Left 1143965946 17:10756602-10756624 CCCACCAGATGCCAGTAGTAACC No data
Right 1143965955 17:10756642-10756664 ACCAGAAATGTCTCCAAACCTGG No data
1143965943_1143965955 29 Left 1143965943 17:10756590-10756612 CCCTGGCCTCTACCCACCAGATG 0: 28
1: 272
2: 777
3: 1210
4: 1515
Right 1143965955 17:10756642-10756664 ACCAGAAATGTCTCCAAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143965955 Original CRISPR ACCAGAAATGTCTCCAAACC TGG Intergenic
No off target data available for this crispr