ID: 1143967717

View in Genome Browser
Species Human (GRCh38)
Location 17:10768652-10768674
Sequence TCACTCTCTCAGTTTAAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143967709_1143967717 30 Left 1143967709 17:10768599-10768621 CCAGAAAGTGCCTGCAACAATAC No data
Right 1143967717 17:10768652-10768674 TCACTCTCTCAGTTTAAAGGTGG No data
1143967712_1143967717 0 Left 1143967712 17:10768629-10768651 CCCATATGTGCTTCTAGAGCCGG No data
Right 1143967717 17:10768652-10768674 TCACTCTCTCAGTTTAAAGGTGG No data
1143967714_1143967717 -1 Left 1143967714 17:10768630-10768652 CCATATGTGCTTCTAGAGCCGGT No data
Right 1143967717 17:10768652-10768674 TCACTCTCTCAGTTTAAAGGTGG No data
1143967710_1143967717 20 Left 1143967710 17:10768609-10768631 CCTGCAACAATACTTCCAGTCCC No data
Right 1143967717 17:10768652-10768674 TCACTCTCTCAGTTTAAAGGTGG No data
1143967711_1143967717 5 Left 1143967711 17:10768624-10768646 CCAGTCCCATATGTGCTTCTAGA No data
Right 1143967717 17:10768652-10768674 TCACTCTCTCAGTTTAAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143967717 Original CRISPR TCACTCTCTCAGTTTAAAGG TGG Intergenic
No off target data available for this crispr