ID: 1143971146

View in Genome Browser
Species Human (GRCh38)
Location 17:10796847-10796869
Sequence GAAACATACGTGACTAGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143971138_1143971146 22 Left 1143971138 17:10796802-10796824 CCCCACATGCAGGCATGGATCAA No data
Right 1143971146 17:10796847-10796869 GAAACATACGTGACTAGGCCAGG No data
1143971139_1143971146 21 Left 1143971139 17:10796803-10796825 CCCACATGCAGGCATGGATCAAG No data
Right 1143971146 17:10796847-10796869 GAAACATACGTGACTAGGCCAGG No data
1143971135_1143971146 28 Left 1143971135 17:10796796-10796818 CCCGTTCCCCACATGCAGGCATG No data
Right 1143971146 17:10796847-10796869 GAAACATACGTGACTAGGCCAGG No data
1143971136_1143971146 27 Left 1143971136 17:10796797-10796819 CCGTTCCCCACATGCAGGCATGG No data
Right 1143971146 17:10796847-10796869 GAAACATACGTGACTAGGCCAGG No data
1143971140_1143971146 20 Left 1143971140 17:10796804-10796826 CCACATGCAGGCATGGATCAAGG No data
Right 1143971146 17:10796847-10796869 GAAACATACGTGACTAGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143971146 Original CRISPR GAAACATACGTGACTAGGCC AGG Intergenic
No off target data available for this crispr