ID: 1143973558

View in Genome Browser
Species Human (GRCh38)
Location 17:10813440-10813462
Sequence AGATCATGGTCCTTCACCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143973558_1143973563 21 Left 1143973558 17:10813440-10813462 CCAGAGGTGAAGGACCATGATCT No data
Right 1143973563 17:10813484-10813506 CACTGACCAAGGCTTCCCTGAGG No data
1143973558_1143973560 -3 Left 1143973558 17:10813440-10813462 CCAGAGGTGAAGGACCATGATCT No data
Right 1143973560 17:10813460-10813482 TCTATGAGAATGTGATAAAGAGG No data
1143973558_1143973562 10 Left 1143973558 17:10813440-10813462 CCAGAGGTGAAGGACCATGATCT No data
Right 1143973562 17:10813473-10813495 GATAAAGAGGGCACTGACCAAGG No data
1143973558_1143973561 -2 Left 1143973558 17:10813440-10813462 CCAGAGGTGAAGGACCATGATCT No data
Right 1143973561 17:10813461-10813483 CTATGAGAATGTGATAAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143973558 Original CRISPR AGATCATGGTCCTTCACCTC TGG (reversed) Intergenic
No off target data available for this crispr