ID: 1143973561

View in Genome Browser
Species Human (GRCh38)
Location 17:10813461-10813483
Sequence CTATGAGAATGTGATAAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143973558_1143973561 -2 Left 1143973558 17:10813440-10813462 CCAGAGGTGAAGGACCATGATCT No data
Right 1143973561 17:10813461-10813483 CTATGAGAATGTGATAAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143973561 Original CRISPR CTATGAGAATGTGATAAAGA GGG Intergenic
No off target data available for this crispr