ID: 1143976978

View in Genome Browser
Species Human (GRCh38)
Location 17:10837309-10837331
Sequence GACAAAGACGTGGCTCAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 118}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143976978_1143976987 30 Left 1143976978 17:10837309-10837331 CCTGACTGAGCCACGTCTTTGTC 0: 1
1: 0
2: 0
3: 3
4: 118
Right 1143976987 17:10837362-10837384 TGTCTGAGATAAAACTCCCGAGG 0: 1
1: 0
2: 0
3: 5
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143976978 Original CRISPR GACAAAGACGTGGCTCAGTC AGG (reversed) Intronic