ID: 1143976978

View in Genome Browser
Species Human (GRCh38)
Location 17:10837309-10837331
Sequence GACAAAGACGTGGCTCAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 118}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143976978_1143976987 30 Left 1143976978 17:10837309-10837331 CCTGACTGAGCCACGTCTTTGTC 0: 1
1: 0
2: 0
3: 3
4: 118
Right 1143976987 17:10837362-10837384 TGTCTGAGATAAAACTCCCGAGG 0: 1
1: 0
2: 0
3: 5
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143976978 Original CRISPR GACAAAGACGTGGCTCAGTC AGG (reversed) Intronic
900266505 1:1759888-1759910 GACAAAGGAGTGGCTCTGCCAGG + Exonic
901750950 1:11408022-11408044 GACAAAGACATGCCTGAGACTGG - Intergenic
903134782 1:21302383-21302405 GAGAAAGTCGAGGCTCAGACAGG - Intronic
904320729 1:29696479-29696501 GACAAAGAAGGGGATCAGTAGGG - Intergenic
907949625 1:59169851-59169873 GATAAAGAAGGGGCTGAGTCAGG - Intergenic
912549713 1:110477498-110477520 CAGAAAGAGGTGGCTGAGTCTGG + Intergenic
914251426 1:145924989-145925011 GAAAAGGATGTGGCTCAGGCTGG - Intergenic
914899604 1:151704775-151704797 TACAAAGACTTGGCTCTTTCTGG + Intronic
920670787 1:208002437-208002459 TTCAAAGACGTGGCCCAGACTGG - Intergenic
922659882 1:227420574-227420596 GACAAAGTCGAGGCTCAGTGGGG + Intergenic
1063230395 10:4060492-4060514 GCCAAAGATGTGGCACAGGCTGG + Intergenic
1072100748 10:92226946-92226968 GACAAAATTGGGGCTCAGTCAGG - Intronic
1074254274 10:111784692-111784714 GACAAAGACCTGAGTCAGTAGGG + Intergenic
1074773439 10:116748561-116748583 GACAAAGACATGCCTGAGACTGG + Intergenic
1076990204 11:268863-268885 AACAAAGACGTAGCTCCTTCTGG + Intergenic
1078132879 11:8627610-8627632 GACAAAGATGAGGCTCAGAAGGG + Intronic
1078903043 11:15659249-15659271 CACTAAAACATGGCTCAGTCAGG + Intergenic
1081845234 11:46236792-46236814 GACAAAGACGTGGCTAGGGGAGG + Intergenic
1082659596 11:55894402-55894424 GACAAAGATGTGTCTCAGGGGGG - Intergenic
1083910900 11:65709142-65709164 GAAAAAGATGTTGCTCAGGCTGG - Intergenic
1085079303 11:73620946-73620968 GACAAGGAAGTGGCCCAGGCAGG + Intergenic
1088874472 11:113922522-113922544 AACACAGACTTGGCTCAGCCCGG - Intronic
1091274593 11:134341978-134342000 AACAAGGGCGTGGCTGAGTCCGG - Intronic
1094649796 12:32364445-32364467 GACACATCCGTGGCTCAGCCAGG + Intronic
1095699188 12:45173845-45173867 GACAATAACTTGTCTCAGTCTGG - Intergenic
1095945279 12:47750093-47750115 GACAAAGATGTGGCCAGGTCAGG + Intronic
1096428923 12:51527377-51527399 GACAATGAGGGGCCTCAGTCTGG - Intergenic
1100194022 12:92223747-92223769 GAAAAAGAAGAGGCTCAGTCAGG + Intergenic
1100665914 12:96752921-96752943 GACAAAGCAGTAGCTCAGTGAGG - Intronic
1101285677 12:103309844-103309866 GACAAAGCTGTGGCTCAGGAGGG - Intronic
1101583891 12:106067646-106067668 GAGAATGACTTTGCTCAGTCTGG - Exonic
1106020178 13:25906789-25906811 GACGAAGACATGGCTTACTCAGG - Intronic
1112660160 13:101498796-101498818 GATAAAGACGTACCTGAGTCTGG + Intronic
1117889134 14:60399153-60399175 GAAAAGGATGTGGCTCAGGCTGG + Intronic
1120310304 14:82818384-82818406 GAGAAAGAGGTGGCTGAGTGCGG + Intergenic
1120470664 14:84919506-84919528 GAGAAAGTAGTGTCTCAGTCAGG - Intergenic
1121192106 14:92039947-92039969 GAGAAAGAAGTGGCCCAATCTGG - Exonic
1121631146 14:95422771-95422793 GGCCAACACGTGGCTCAGTGAGG - Intronic
1128511974 15:68318957-68318979 GACACAGACATGGCTAAGACAGG + Intronic
1131270230 15:90942774-90942796 GACAAAGCTGGAGCTCAGTCTGG + Intronic
1137570554 16:49563644-49563666 GCCAAAGACGTGGCTCTGGGAGG - Intronic
1138242678 16:55440656-55440678 AACAAATACCTGGCACAGTCAGG + Intronic
1139126774 16:64088085-64088107 GACAAAAACTTTGCTCATTCAGG + Intergenic
1140623528 16:76764828-76764850 GACAAAGAAGTACCTGAGTCTGG - Intergenic
1142816924 17:2433886-2433908 GAAAAGGAAGTGGCTCAGGCTGG - Intronic
1143976978 17:10837309-10837331 GACAAAGACGTGGCTCAGTCAGG - Intronic
1144499931 17:15777775-15777797 GATAAAGACATGGCTGAGACTGG + Intergenic
1145957364 17:28863813-28863835 GACAAAGCTGTGGCTCTCTCAGG + Intergenic
1148320251 17:46744810-46744832 GAAAAAGGCAGGGCTCAGTCAGG - Intronic
1157290003 18:46402977-46402999 GCCACAGACGTGGCTCAGAAAGG - Intronic
1158582935 18:58701177-58701199 GACATAGACAGGCCTCAGTCTGG + Intronic
1159033755 18:63257849-63257871 GACACAGACGAGGCTGAATCAGG + Intronic
1166528757 19:43529803-43529825 GACCCAGAGGTGACTCAGTCTGG + Intronic
1167193668 19:48010617-48010639 CATGAAGACTTGGCTCAGTCTGG - Intronic
1167775348 19:51551008-51551030 GAGGAAGAGGTTGCTCAGTCGGG - Intergenic
1168348913 19:55664648-55664670 GACACAGATGTGCCTCCGTCTGG - Intronic
1168683524 19:58334118-58334140 GAGAAAGACTTGGCTCTGTTGGG + Intronic
927099171 2:19774757-19774779 GACAATGAAGTGACACAGTCAGG - Intergenic
934610300 2:95730501-95730523 GAGAAAGAGCTGGCTGAGTCTGG + Intergenic
936543629 2:113372087-113372109 GAGAAAGAGCTGGCTGAGTCTGG + Intergenic
941492061 2:166154699-166154721 GAGAAGGACGAGGCTCAGGCAGG + Intergenic
942043887 2:172087969-172087991 GACAACAACGTGACTCAGGCTGG - Intronic
948106598 2:235419590-235419612 GGCCCAGACGCGGCTCAGTCAGG - Intergenic
1169569187 20:6888143-6888165 GACAAGTATGAGGCTCAGTCTGG + Intergenic
1173751731 20:45481711-45481733 GAGAAAAACGAGGCTCAGACAGG + Intergenic
1174172321 20:48625374-48625396 GGAAAAGACTTGGCTCTGTCGGG - Exonic
1175925532 20:62469524-62469546 GTCTCAGACGTGGCTCCGTCGGG - Intronic
1176024669 20:62979670-62979692 GCCAAGGACGTGGCTCTGTCTGG + Intergenic
1177307283 21:19335302-19335324 TACAAACAAGTTGCTCAGTCAGG - Intergenic
1179179998 21:39036749-39036771 GACAAAGAAGTGGCAGAGACTGG - Intergenic
1179572810 21:42287858-42287880 GACACAGACGGGGGTCAGCCCGG - Intronic
1180987728 22:19915290-19915312 GAGAAAGCCGTGGGTCAGACAGG + Intronic
1182260211 22:29068734-29068756 GACAAGGAGGTGGCTCAACCTGG + Intergenic
1185022878 22:48390368-48390390 GATAAAGACGTGCCTGAGACTGG + Intergenic
949870209 3:8581906-8581928 GGCAAAGACCAGGCTCAGTATGG - Intergenic
950563587 3:13750419-13750441 GAGAAAGCCGTGGCTCAGAGAGG - Intergenic
952406973 3:33013716-33013738 GACAAAGAGGTGGATCCCTCTGG - Intronic
954332276 3:49897424-49897446 GACATAGAGGTGGCTTAGGCAGG + Intronic
959361992 3:105404985-105405007 GACAAAGAGGGGGCCCAGTGGGG + Intronic
965266539 3:166550796-166550818 GACAAACAAGGGGCTCAGTATGG + Intergenic
968264785 3:197354756-197354778 GACAAAGCAGTGGCTCAGCTGGG + Intergenic
972661596 4:41121803-41121825 CACAAAGACGTGGCTGCATCCGG - Intronic
980582694 4:134774129-134774151 GACAAAGACATGCCTGAGACTGG - Intergenic
980708342 4:136529600-136529622 GACAAAGACATGGCTCTGAGAGG + Intergenic
986789495 5:11145875-11145897 GACAGACAGGTGGCTCAGTGTGG - Intronic
990948997 5:61277897-61277919 AACAAGGACGTGGCTGAGCCGGG - Intergenic
993033589 5:82732499-82732521 GACAAAGACATGCCTGAGACTGG + Intergenic
999040889 5:148410514-148410536 GACAAAGACGTACCTGAGACTGG - Intronic
1000095717 5:157969227-157969249 TACAAACACCTGGCCCAGTCCGG - Intergenic
1000628524 5:163566237-163566259 GTCAAAGCCCAGGCTCAGTCGGG + Intergenic
1001824250 5:174732978-174733000 CACAAAGAGGTGGCTCACTAAGG + Intergenic
1003816541 6:9847688-9847710 AACAAACACGTGTCTCAGCCAGG - Intronic
1005825400 6:29628819-29628841 GACACCGGCGAGGCTCAGTCTGG + Intronic
1007023865 6:38549970-38549992 GACAAAGTGGTGGCTCAGCGAGG - Intronic
1008798431 6:55336232-55336254 GACAAAGAAGTGGCCCGGCCCGG - Intronic
1010104228 6:72148765-72148787 GACAAAAAGGTGCCTCAGTAGGG + Intronic
1011802838 6:91037100-91037122 GACCAAGACCTGCCTGAGTCAGG + Intergenic
1019137569 6:169920707-169920729 GAGAAAGACGTGGCCTTGTCTGG - Intergenic
1020204552 7:6104932-6104954 GACAATGACGTGCCTCCATCCGG - Exonic
1022402622 7:30054759-30054781 GACAATAACTTGACTCAGTCTGG + Exonic
1026329736 7:69341386-69341408 GACAATGACTTCGCTCATTCTGG - Intergenic
1028133313 7:87202462-87202484 GACAAAGACATGAATCCGTCAGG - Intronic
1028458347 7:91062715-91062737 GACAAAGCCGAAGCTCAGTGAGG + Intronic
1028490646 7:91407675-91407697 GATAAAGACCTGGCTAAGCCAGG + Intergenic
1029297943 7:99556329-99556351 GTCAAAGTCGTGGCTCATACAGG - Intronic
1031752120 7:125589111-125589133 TACAAAGAAGTGGCCAAGTCTGG + Intergenic
1031997133 7:128240506-128240528 GACAAAAACGTGGCTACATCTGG + Intergenic
1034502707 7:151461223-151461245 GACAAAGACTTGGAACATTCCGG - Intergenic
1035488580 7:159252290-159252312 GACATAGACTTGGCTAAGACTGG - Intergenic
1037540869 8:19869667-19869689 GACAAAAACGTGGTTCAGGAGGG + Intergenic
1039917195 8:41868894-41868916 GAAAAAGATGAGGCTCAGACGGG + Intronic
1041205243 8:55492947-55492969 TACAAAGCTGTGGCTCAGACAGG + Intronic
1049360923 8:142212322-142212344 GAGAAAGTGGAGGCTCAGTCAGG + Intronic
1052002659 9:23305678-23305700 GACAAAGACATGGTACAGTATGG + Intergenic
1057833473 9:98425675-98425697 GACAAAAATGAGGCTCAGACAGG + Intronic
1187851055 X:23592134-23592156 GATAAAGACGTACCTCAGACTGG - Intergenic
1195822988 X:108967629-108967651 GACAAAGAATTGGCTCTGTTTGG - Intergenic
1198321166 X:135520644-135520666 AACAGAGACGGCGCTCAGTCTGG + Exonic
1198722285 X:139635772-139635794 GACAAACACGTGTCACAGTGGGG + Intronic
1199515098 X:148667496-148667518 GATAAAGACGTACCTGAGTCTGG + Intronic
1201236556 Y:11917434-11917456 GACAAAGATATGGCTGAGACTGG - Intergenic
1201738944 Y:17303118-17303140 GATAAAGACATGCCTCAGACTGG - Intergenic