ID: 1143977255

View in Genome Browser
Species Human (GRCh38)
Location 17:10838966-10838988
Sequence CTGTTGTTCCTCAGGATAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143977251_1143977255 3 Left 1143977251 17:10838940-10838962 CCACACTAACCTGAGAACGTGGG No data
Right 1143977255 17:10838966-10838988 CTGTTGTTCCTCAGGATAACTGG No data
1143977249_1143977255 4 Left 1143977249 17:10838939-10838961 CCCACACTAACCTGAGAACGTGG No data
Right 1143977255 17:10838966-10838988 CTGTTGTTCCTCAGGATAACTGG No data
1143977248_1143977255 9 Left 1143977248 17:10838934-10838956 CCTGGCCCACACTAACCTGAGAA No data
Right 1143977255 17:10838966-10838988 CTGTTGTTCCTCAGGATAACTGG No data
1143977246_1143977255 14 Left 1143977246 17:10838929-10838951 CCTGCCCTGGCCCACACTAACCT No data
Right 1143977255 17:10838966-10838988 CTGTTGTTCCTCAGGATAACTGG No data
1143977247_1143977255 10 Left 1143977247 17:10838933-10838955 CCCTGGCCCACACTAACCTGAGA No data
Right 1143977255 17:10838966-10838988 CTGTTGTTCCTCAGGATAACTGG No data
1143977253_1143977255 -6 Left 1143977253 17:10838949-10838971 CCTGAGAACGTGGGCAGCTGTTG No data
Right 1143977255 17:10838966-10838988 CTGTTGTTCCTCAGGATAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143977255 Original CRISPR CTGTTGTTCCTCAGGATAAC TGG Intergenic
No off target data available for this crispr