ID: 1143982204

View in Genome Browser
Species Human (GRCh38)
Location 17:10879833-10879855
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143982204_1143982216 15 Left 1143982204 17:10879833-10879855 CCTCTCCCCGCCCTTTCCCAGCT No data
Right 1143982216 17:10879871-10879893 TTGGGCTCAGCCCCGGCGGAAGG No data
1143982204_1143982215 11 Left 1143982204 17:10879833-10879855 CCTCTCCCCGCCCTTTCCCAGCT No data
Right 1143982215 17:10879867-10879889 TAACTTGGGCTCAGCCCCGGCGG No data
1143982204_1143982218 23 Left 1143982204 17:10879833-10879855 CCTCTCCCCGCCCTTTCCCAGCT No data
Right 1143982218 17:10879879-10879901 AGCCCCGGCGGAAGGACCAAGGG No data
1143982204_1143982214 8 Left 1143982204 17:10879833-10879855 CCTCTCCCCGCCCTTTCCCAGCT No data
Right 1143982214 17:10879864-10879886 GCTTAACTTGGGCTCAGCCCCGG No data
1143982204_1143982222 27 Left 1143982204 17:10879833-10879855 CCTCTCCCCGCCCTTTCCCAGCT No data
Right 1143982222 17:10879883-10879905 CCGGCGGAAGGACCAAGGGTTGG No data
1143982204_1143982213 -3 Left 1143982204 17:10879833-10879855 CCTCTCCCCGCCCTTTCCCAGCT No data
Right 1143982213 17:10879853-10879875 GCTCAGTGTCTGCTTAACTTGGG No data
1143982204_1143982217 22 Left 1143982204 17:10879833-10879855 CCTCTCCCCGCCCTTTCCCAGCT No data
Right 1143982217 17:10879878-10879900 CAGCCCCGGCGGAAGGACCAAGG No data
1143982204_1143982212 -4 Left 1143982204 17:10879833-10879855 CCTCTCCCCGCCCTTTCCCAGCT No data
Right 1143982212 17:10879852-10879874 AGCTCAGTGTCTGCTTAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143982204 Original CRISPR AGCTGGGAAAGGGCGGGGAG AGG (reversed) Intergenic
No off target data available for this crispr