ID: 1143982209

View in Genome Browser
Species Human (GRCh38)
Location 17:10879844-10879866
Sequence AGCAGACACTGAGCTGGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143982209_1143982225 28 Left 1143982209 17:10879844-10879866 CCTTTCCCAGCTCAGTGTCTGCT No data
Right 1143982225 17:10879895-10879917 CCAAGGGTTGGTTGTTCACTGGG No data
1143982209_1143982218 12 Left 1143982209 17:10879844-10879866 CCTTTCCCAGCTCAGTGTCTGCT No data
Right 1143982218 17:10879879-10879901 AGCCCCGGCGGAAGGACCAAGGG No data
1143982209_1143982223 27 Left 1143982209 17:10879844-10879866 CCTTTCCCAGCTCAGTGTCTGCT No data
Right 1143982223 17:10879894-10879916 ACCAAGGGTTGGTTGTTCACTGG No data
1143982209_1143982215 0 Left 1143982209 17:10879844-10879866 CCTTTCCCAGCTCAGTGTCTGCT No data
Right 1143982215 17:10879867-10879889 TAACTTGGGCTCAGCCCCGGCGG No data
1143982209_1143982222 16 Left 1143982209 17:10879844-10879866 CCTTTCCCAGCTCAGTGTCTGCT No data
Right 1143982222 17:10879883-10879905 CCGGCGGAAGGACCAAGGGTTGG No data
1143982209_1143982214 -3 Left 1143982209 17:10879844-10879866 CCTTTCCCAGCTCAGTGTCTGCT No data
Right 1143982214 17:10879864-10879886 GCTTAACTTGGGCTCAGCCCCGG No data
1143982209_1143982217 11 Left 1143982209 17:10879844-10879866 CCTTTCCCAGCTCAGTGTCTGCT No data
Right 1143982217 17:10879878-10879900 CAGCCCCGGCGGAAGGACCAAGG No data
1143982209_1143982216 4 Left 1143982209 17:10879844-10879866 CCTTTCCCAGCTCAGTGTCTGCT No data
Right 1143982216 17:10879871-10879893 TTGGGCTCAGCCCCGGCGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143982209 Original CRISPR AGCAGACACTGAGCTGGGAA AGG (reversed) Intergenic
No off target data available for this crispr