ID: 1143982210

View in Genome Browser
Species Human (GRCh38)
Location 17:10879849-10879871
Sequence AGTTAAGCAGACACTGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143982210_1143982225 23 Left 1143982210 17:10879849-10879871 CCCAGCTCAGTGTCTGCTTAACT No data
Right 1143982225 17:10879895-10879917 CCAAGGGTTGGTTGTTCACTGGG No data
1143982210_1143982216 -1 Left 1143982210 17:10879849-10879871 CCCAGCTCAGTGTCTGCTTAACT No data
Right 1143982216 17:10879871-10879893 TTGGGCTCAGCCCCGGCGGAAGG No data
1143982210_1143982223 22 Left 1143982210 17:10879849-10879871 CCCAGCTCAGTGTCTGCTTAACT No data
Right 1143982223 17:10879894-10879916 ACCAAGGGTTGGTTGTTCACTGG No data
1143982210_1143982214 -8 Left 1143982210 17:10879849-10879871 CCCAGCTCAGTGTCTGCTTAACT No data
Right 1143982214 17:10879864-10879886 GCTTAACTTGGGCTCAGCCCCGG No data
1143982210_1143982226 30 Left 1143982210 17:10879849-10879871 CCCAGCTCAGTGTCTGCTTAACT No data
Right 1143982226 17:10879902-10879924 TTGGTTGTTCACTGGGAACCTGG No data
1143982210_1143982218 7 Left 1143982210 17:10879849-10879871 CCCAGCTCAGTGTCTGCTTAACT No data
Right 1143982218 17:10879879-10879901 AGCCCCGGCGGAAGGACCAAGGG No data
1143982210_1143982222 11 Left 1143982210 17:10879849-10879871 CCCAGCTCAGTGTCTGCTTAACT No data
Right 1143982222 17:10879883-10879905 CCGGCGGAAGGACCAAGGGTTGG No data
1143982210_1143982217 6 Left 1143982210 17:10879849-10879871 CCCAGCTCAGTGTCTGCTTAACT No data
Right 1143982217 17:10879878-10879900 CAGCCCCGGCGGAAGGACCAAGG No data
1143982210_1143982215 -5 Left 1143982210 17:10879849-10879871 CCCAGCTCAGTGTCTGCTTAACT No data
Right 1143982215 17:10879867-10879889 TAACTTGGGCTCAGCCCCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143982210 Original CRISPR AGTTAAGCAGACACTGAGCT GGG (reversed) Intergenic
No off target data available for this crispr