ID: 1143982212

View in Genome Browser
Species Human (GRCh38)
Location 17:10879852-10879874
Sequence AGCTCAGTGTCTGCTTAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143982205_1143982212 -9 Left 1143982205 17:10879838-10879860 CCCCGCCCTTTCCCAGCTCAGTG No data
Right 1143982212 17:10879852-10879874 AGCTCAGTGTCTGCTTAACTTGG No data
1143982204_1143982212 -4 Left 1143982204 17:10879833-10879855 CCTCTCCCCGCCCTTTCCCAGCT No data
Right 1143982212 17:10879852-10879874 AGCTCAGTGTCTGCTTAACTTGG No data
1143982206_1143982212 -10 Left 1143982206 17:10879839-10879861 CCCGCCCTTTCCCAGCTCAGTGT No data
Right 1143982212 17:10879852-10879874 AGCTCAGTGTCTGCTTAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143982212 Original CRISPR AGCTCAGTGTCTGCTTAACT TGG Intergenic
No off target data available for this crispr