ID: 1143982213

View in Genome Browser
Species Human (GRCh38)
Location 17:10879853-10879875
Sequence GCTCAGTGTCTGCTTAACTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143982207_1143982213 -10 Left 1143982207 17:10879840-10879862 CCGCCCTTTCCCAGCTCAGTGTC No data
Right 1143982213 17:10879853-10879875 GCTCAGTGTCTGCTTAACTTGGG No data
1143982206_1143982213 -9 Left 1143982206 17:10879839-10879861 CCCGCCCTTTCCCAGCTCAGTGT No data
Right 1143982213 17:10879853-10879875 GCTCAGTGTCTGCTTAACTTGGG No data
1143982204_1143982213 -3 Left 1143982204 17:10879833-10879855 CCTCTCCCCGCCCTTTCCCAGCT No data
Right 1143982213 17:10879853-10879875 GCTCAGTGTCTGCTTAACTTGGG No data
1143982205_1143982213 -8 Left 1143982205 17:10879838-10879860 CCCCGCCCTTTCCCAGCTCAGTG No data
Right 1143982213 17:10879853-10879875 GCTCAGTGTCTGCTTAACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143982213 Original CRISPR GCTCAGTGTCTGCTTAACTT GGG Intergenic
No off target data available for this crispr