ID: 1143982219

View in Genome Browser
Species Human (GRCh38)
Location 17:10879881-10879903
Sequence AACCCTTGGTCCTTCCGCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143982219_1143982225 -9 Left 1143982219 17:10879881-10879903 CCCCGGCGGAAGGACCAAGGGTT No data
Right 1143982225 17:10879895-10879917 CCAAGGGTTGGTTGTTCACTGGG No data
1143982219_1143982223 -10 Left 1143982219 17:10879881-10879903 CCCCGGCGGAAGGACCAAGGGTT No data
Right 1143982223 17:10879894-10879916 ACCAAGGGTTGGTTGTTCACTGG No data
1143982219_1143982226 -2 Left 1143982219 17:10879881-10879903 CCCCGGCGGAAGGACCAAGGGTT No data
Right 1143982226 17:10879902-10879924 TTGGTTGTTCACTGGGAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143982219 Original CRISPR AACCCTTGGTCCTTCCGCCG GGG (reversed) Intergenic
No off target data available for this crispr