ID: 1143982220

View in Genome Browser
Species Human (GRCh38)
Location 17:10879882-10879904
Sequence CAACCCTTGGTCCTTCCGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143982220_1143982225 -10 Left 1143982220 17:10879882-10879904 CCCGGCGGAAGGACCAAGGGTTG No data
Right 1143982225 17:10879895-10879917 CCAAGGGTTGGTTGTTCACTGGG No data
1143982220_1143982226 -3 Left 1143982220 17:10879882-10879904 CCCGGCGGAAGGACCAAGGGTTG No data
Right 1143982226 17:10879902-10879924 TTGGTTGTTCACTGGGAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143982220 Original CRISPR CAACCCTTGGTCCTTCCGCC GGG (reversed) Intergenic
No off target data available for this crispr