ID: 1143982221

View in Genome Browser
Species Human (GRCh38)
Location 17:10879883-10879905
Sequence CCAACCCTTGGTCCTTCCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143982221_1143982226 -4 Left 1143982221 17:10879883-10879905 CCGGCGGAAGGACCAAGGGTTGG No data
Right 1143982226 17:10879902-10879924 TTGGTTGTTCACTGGGAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143982221 Original CRISPR CCAACCCTTGGTCCTTCCGC CGG (reversed) Intergenic
No off target data available for this crispr