ID: 1143982222

View in Genome Browser
Species Human (GRCh38)
Location 17:10879883-10879905
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143982205_1143982222 22 Left 1143982205 17:10879838-10879860 CCCCGCCCTTTCCCAGCTCAGTG No data
Right 1143982222 17:10879883-10879905 CCGGCGGAAGGACCAAGGGTTGG No data
1143982209_1143982222 16 Left 1143982209 17:10879844-10879866 CCTTTCCCAGCTCAGTGTCTGCT No data
Right 1143982222 17:10879883-10879905 CCGGCGGAAGGACCAAGGGTTGG No data
1143982208_1143982222 17 Left 1143982208 17:10879843-10879865 CCCTTTCCCAGCTCAGTGTCTGC No data
Right 1143982222 17:10879883-10879905 CCGGCGGAAGGACCAAGGGTTGG No data
1143982204_1143982222 27 Left 1143982204 17:10879833-10879855 CCTCTCCCCGCCCTTTCCCAGCT No data
Right 1143982222 17:10879883-10879905 CCGGCGGAAGGACCAAGGGTTGG No data
1143982207_1143982222 20 Left 1143982207 17:10879840-10879862 CCGCCCTTTCCCAGCTCAGTGTC No data
Right 1143982222 17:10879883-10879905 CCGGCGGAAGGACCAAGGGTTGG No data
1143982210_1143982222 11 Left 1143982210 17:10879849-10879871 CCCAGCTCAGTGTCTGCTTAACT No data
Right 1143982222 17:10879883-10879905 CCGGCGGAAGGACCAAGGGTTGG No data
1143982206_1143982222 21 Left 1143982206 17:10879839-10879861 CCCGCCCTTTCCCAGCTCAGTGT No data
Right 1143982222 17:10879883-10879905 CCGGCGGAAGGACCAAGGGTTGG No data
1143982211_1143982222 10 Left 1143982211 17:10879850-10879872 CCAGCTCAGTGTCTGCTTAACTT No data
Right 1143982222 17:10879883-10879905 CCGGCGGAAGGACCAAGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143982222 Original CRISPR CCGGCGGAAGGACCAAGGGT TGG Intergenic
No off target data available for this crispr