ID: 1143982223

View in Genome Browser
Species Human (GRCh38)
Location 17:10879894-10879916
Sequence ACCAAGGGTTGGTTGTTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143982210_1143982223 22 Left 1143982210 17:10879849-10879871 CCCAGCTCAGTGTCTGCTTAACT No data
Right 1143982223 17:10879894-10879916 ACCAAGGGTTGGTTGTTCACTGG No data
1143982208_1143982223 28 Left 1143982208 17:10879843-10879865 CCCTTTCCCAGCTCAGTGTCTGC No data
Right 1143982223 17:10879894-10879916 ACCAAGGGTTGGTTGTTCACTGG No data
1143982209_1143982223 27 Left 1143982209 17:10879844-10879866 CCTTTCCCAGCTCAGTGTCTGCT No data
Right 1143982223 17:10879894-10879916 ACCAAGGGTTGGTTGTTCACTGG No data
1143982211_1143982223 21 Left 1143982211 17:10879850-10879872 CCAGCTCAGTGTCTGCTTAACTT No data
Right 1143982223 17:10879894-10879916 ACCAAGGGTTGGTTGTTCACTGG No data
1143982219_1143982223 -10 Left 1143982219 17:10879881-10879903 CCCCGGCGGAAGGACCAAGGGTT No data
Right 1143982223 17:10879894-10879916 ACCAAGGGTTGGTTGTTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143982223 Original CRISPR ACCAAGGGTTGGTTGTTCAC TGG Intergenic
No off target data available for this crispr